ID: 1038072553

View in Genome Browser
Species Human (GRCh38)
Location 8:24033407-24033429
Sequence GAAAAAGCACAGAAGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038072553_1038072555 3 Left 1038072553 8:24033407-24033429 CCCAGAGGCTTCTGTGCTTTTTC No data
Right 1038072555 8:24033433-24033455 TGTCAGTTACGCCACAGTCCTGG No data
1038072553_1038072557 11 Left 1038072553 8:24033407-24033429 CCCAGAGGCTTCTGTGCTTTTTC No data
Right 1038072557 8:24033441-24033463 ACGCCACAGTCCTGGCTTATGGG No data
1038072553_1038072559 17 Left 1038072553 8:24033407-24033429 CCCAGAGGCTTCTGTGCTTTTTC No data
Right 1038072559 8:24033447-24033469 CAGTCCTGGCTTATGGGTTCTGG No data
1038072553_1038072556 10 Left 1038072553 8:24033407-24033429 CCCAGAGGCTTCTGTGCTTTTTC No data
Right 1038072556 8:24033440-24033462 TACGCCACAGTCCTGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038072553 Original CRISPR GAAAAAGCACAGAAGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr