ID: 1038079214

View in Genome Browser
Species Human (GRCh38)
Location 8:24114122-24114144
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038079214_1038079219 18 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079219 8:24114163-24114185 TATGGAATAAAGTGGGAGTAAGG No data
1038079214_1038079224 26 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079224 8:24114171-24114193 AAAGTGGGAGTAAGGGGCCGGGG No data
1038079214_1038079223 25 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079223 8:24114170-24114192 TAAAGTGGGAGTAAGGGGCCGGG No data
1038079214_1038079225 30 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079225 8:24114175-24114197 TGGGAGTAAGGGGCCGGGGAAGG No data
1038079214_1038079217 10 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079217 8:24114155-24114177 TCTTTGAGTATGGAATAAAGTGG No data
1038079214_1038079220 19 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079220 8:24114164-24114186 ATGGAATAAAGTGGGAGTAAGGG No data
1038079214_1038079221 20 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079221 8:24114165-24114187 TGGAATAAAGTGGGAGTAAGGGG No data
1038079214_1038079222 24 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079222 8:24114169-24114191 ATAAAGTGGGAGTAAGGGGCCGG No data
1038079214_1038079218 11 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG No data
1038079214_1038079216 0 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079216 8:24114145-24114167 GCAAGATTACTCTTTGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038079214 Original CRISPR TGTTGATTAATTAATTTTAA GGG (reversed) Intergenic
No off target data available for this crispr