ID: 1038079218

View in Genome Browser
Species Human (GRCh38)
Location 8:24114156-24114178
Sequence CTTTGAGTATGGAATAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038079215_1038079218 10 Left 1038079215 8:24114123-24114145 CCTTAAAATTAATTAATCAACAG No data
Right 1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG No data
1038079214_1038079218 11 Left 1038079214 8:24114122-24114144 CCCTTAAAATTAATTAATCAACA No data
Right 1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038079218 Original CRISPR CTTTGAGTATGGAATAAAGT GGG Intergenic
No off target data available for this crispr