ID: 1038080241

View in Genome Browser
Species Human (GRCh38)
Location 8:24126624-24126646
Sequence ATCTAGTTATTTGGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038080241_1038080246 30 Left 1038080241 8:24126624-24126646 CCTGCTTTCCCAAATAACTAGAT No data
Right 1038080246 8:24126677-24126699 AGGATGTTATTCATATGAAGAGG No data
1038080241_1038080245 10 Left 1038080241 8:24126624-24126646 CCTGCTTTCCCAAATAACTAGAT No data
Right 1038080245 8:24126657-24126679 CTAAATACTTCAGAAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038080241 Original CRISPR ATCTAGTTATTTGGGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr