ID: 1038084898

View in Genome Browser
Species Human (GRCh38)
Location 8:24185195-24185217
Sequence CAGAACATGGAGAACTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038084893_1038084898 9 Left 1038084893 8:24185163-24185185 CCAGGGGTCACAGGGAGGGATGG No data
Right 1038084898 8:24185195-24185217 CAGAACATGGAGAACTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038084898 Original CRISPR CAGAACATGGAGAACTTTTA GGG Intergenic
No off target data available for this crispr