ID: 1038088466

View in Genome Browser
Species Human (GRCh38)
Location 8:24226970-24226992
Sequence CACTTAACATTGCTGTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038088462_1038088466 23 Left 1038088462 8:24226924-24226946 CCTAGGTTAGTGTCTTTGAGCTG No data
Right 1038088466 8:24226970-24226992 CACTTAACATTGCTGTGGCTTGG No data
1038088463_1038088466 0 Left 1038088463 8:24226947-24226969 CCACTGACTCTTTATGAGCAAGC No data
Right 1038088466 8:24226970-24226992 CACTTAACATTGCTGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038088466 Original CRISPR CACTTAACATTGCTGTGGCT TGG Intergenic
No off target data available for this crispr