ID: 1038089027

View in Genome Browser
Species Human (GRCh38)
Location 8:24233296-24233318
Sequence TGCCAGGAAAATAAGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038089023_1038089027 -3 Left 1038089023 8:24233276-24233298 CCTTACAGAACCTTTTGAGATGC No data
Right 1038089027 8:24233296-24233318 TGCCAGGAAAATAAGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038089027 Original CRISPR TGCCAGGAAAATAAGCTTGG AGG Intergenic
No off target data available for this crispr