ID: 1038092757

View in Genome Browser
Species Human (GRCh38)
Location 8:24272359-24272381
Sequence CAGTGTAGTCAGAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038092757_1038092761 -5 Left 1038092757 8:24272359-24272381 CCACCTTCCTTCTGACTACACTG No data
Right 1038092761 8:24272377-24272399 CACTGACAAATCTCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038092757 Original CRISPR CAGTGTAGTCAGAAGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr