ID: 1038094920

View in Genome Browser
Species Human (GRCh38)
Location 8:24297693-24297715
Sequence CCCTGCTGCCTCCTTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038094920_1038094922 8 Left 1038094920 8:24297693-24297715 CCTGAATTAAGGAGGCAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 442
Right 1038094922 8:24297724-24297746 CAATATCATCAGTTAATTTCTGG No data
1038094920_1038094923 12 Left 1038094920 8:24297693-24297715 CCTGAATTAAGGAGGCAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 442
Right 1038094923 8:24297728-24297750 ATCATCAGTTAATTTCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038094920 Original CRISPR CCCTGCTGCCTCCTTAATTC AGG (reversed) Intronic
900427284 1:2586515-2586537 CCCTCCCGCCTCCTCAATCCGGG - Intronic
900793811 1:4695621-4695643 CCCTGCAGACACCTTGATTCTGG - Intronic
902067127 1:13697969-13697991 CCCTGCTGCCACCTTAATTTTGG + Intergenic
902174300 1:14637898-14637920 CCCTGCTGGCACCTTGATTTTGG - Intronic
903072996 1:20737118-20737140 CCCTGCTGACTCCTTGATGTTGG + Intergenic
903161943 1:21495371-21495393 CCCTTCTGCCTGCCCAATTCTGG + Intergenic
904183905 1:28687706-28687728 CACTGCTACTGCCTTAATTCAGG - Intronic
904203770 1:28839157-28839179 CCCTGCTGTCACCTTGATTTTGG - Intronic
904451861 1:30618452-30618474 CTCTGCTGCCTCATTCATCCAGG - Intergenic
904465787 1:30706889-30706911 CCCTGGAGACTCCTTAAATCAGG + Intergenic
905953245 1:41970928-41970950 CCCTGCTGACACCTTTATTTTGG + Intronic
907290908 1:53412358-53412380 ACCTTCTGCCTCCTTCATGCAGG - Intergenic
907473404 1:54689351-54689373 CCCTGCTGACACCTTAATTTTGG + Intronic
907488772 1:54795388-54795410 CCCTGCTGCCACCTCCTTTCTGG + Intronic
907586563 1:55623165-55623187 ACCTGCTGCCACCTTGATCCTGG - Intergenic
908746371 1:67380688-67380710 CCCTGCTGACACCTTGATTTTGG - Intronic
910211388 1:84797337-84797359 CCCTGCTGACACCTTGATTTCGG - Intergenic
911059732 1:93737573-93737595 CCCTGCTGACATCTTGATTCTGG + Intronic
912367465 1:109146509-109146531 CCCTCCAGCCTCCTTGAATCTGG - Intronic
912823716 1:112887042-112887064 CCATGCTCCCTCCATCATTCAGG + Intergenic
915205095 1:154264331-154264353 CCCTGCTGCCCACGTGATTCTGG + Intronic
915286424 1:154856225-154856247 CCCTGCTGCCTCCTCCCTGCAGG - Intronic
917131433 1:171746176-171746198 CCCTGATGACTCCTTGATCCTGG + Intergenic
918587992 1:186209810-186209832 CCCTGCTGACACCTTGATTTTGG + Intergenic
920196937 1:204234330-204234352 CCCTGCTGGCACCTTGATTTTGG + Intronic
920225948 1:204439105-204439127 CCCTGCAGTCCCCTTCATTCTGG - Intronic
920868668 1:209774859-209774881 TACTGCTGCTTCCTTAGTTCAGG - Intronic
921268251 1:213444022-213444044 CCCTGCTGGCTCCTTGATCTTGG - Intergenic
924557548 1:245130735-245130757 CCCTGCTGCCACCTGGATTTTGG - Intergenic
1062950073 10:1492505-1492527 TCCTGCTGACACCTTGATTCTGG + Intronic
1063018353 10:2101133-2101155 CCCTCTAGCCTCCTTGATTCTGG + Intergenic
1063028068 10:2202549-2202571 CCCTGCTCCCTCTGGAATTCAGG - Intergenic
1063985764 10:11499753-11499775 TCCTGCTGACACCTTAATTTTGG + Intronic
1064018925 10:11793960-11793982 CCCTGCAGCCTCCCTGATCCTGG - Intergenic
1065087207 10:22190701-22190723 CCCTGCCATCTGCTTAATTCTGG + Intergenic
1065288409 10:24207102-24207124 CTCTGCTGCCTCCTTCATCCTGG + Intronic
1066350942 10:34636336-34636358 CACTGCTGCCTCCTCCATCCGGG + Intronic
1066417859 10:35237877-35237899 CCCTGCTGCCTGGTTAGTCCTGG - Intergenic
1066456560 10:35577320-35577342 CCCTGCTGGCACCTTGATTTTGG + Intergenic
1066538700 10:36420759-36420781 CTCTCCTGCATCCTTAATGCAGG + Intergenic
1066637124 10:37514852-37514874 TCCTGCTGTCTCCTTGATTTTGG + Intergenic
1067089809 10:43260733-43260755 CCCTGCTGCCTGCTGACGTCTGG - Intronic
1067352633 10:45490481-45490503 CCCTGCTGCCACCTTCATCTTGG + Intronic
1068486279 10:57663163-57663185 CCCTGCTGACTCCTTGATTTTGG + Intergenic
1070274610 10:74993663-74993685 CCCTGGGGCCTCCTTTAATCTGG + Intronic
1070645372 10:78198453-78198475 CCCTGCCACCTCCTTAACTCTGG - Intergenic
1071017652 10:81017407-81017429 CCCTGCTGACACCTTGATCCTGG - Intergenic
1071070691 10:81690044-81690066 CCCTGCTGGCACCTTAGTTTTGG + Intergenic
1072285266 10:93908422-93908444 TCATGCTGCCTCCATAATTGAGG + Intronic
1073141626 10:101252306-101252328 CCTTGCTGCATCCTTATGTCGGG + Intergenic
1073274756 10:102300626-102300648 CCCCCCTGCTTCCTGAATTCTGG - Intronic
1075127298 10:119710817-119710839 CCCTGCCAACTCCTTAATTTTGG + Intergenic
1076191828 10:128488579-128488601 CCCTGCTCGCTCCTAAATGCCGG - Intergenic
1076635330 10:131878671-131878693 CCCTGCTGACACCTTGATTTTGG - Intergenic
1078375526 11:10790355-10790377 CCCTGCTGACACCTTGATTTTGG - Intergenic
1078928457 11:15894900-15894922 CCCTGCTGACACCTTGATTTTGG - Intergenic
1079142460 11:17821179-17821201 CCCTGCTGACACCTTGATTTTGG + Intronic
1079282601 11:19100943-19100965 CCCTGCTGACACCTTAATCTTGG + Intergenic
1080591014 11:33723205-33723227 CACTGCCACCTCCTTATTTCAGG - Intronic
1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG + Intronic
1080939470 11:36898999-36899021 CCCTGCTGCCAGCTTGATTTAGG + Intergenic
1081047128 11:38289943-38289965 CCATATTGTCTCCTTAATTCAGG - Intergenic
1081860741 11:46332328-46332350 CCCTGAAGCCTCAGTAATTCAGG + Intergenic
1081877638 11:46420711-46420733 CCCTCATCCCTCCTTAACTCTGG - Intronic
1083064962 11:59914950-59914972 CCCTGCTGACACCTTTATTTTGG - Intergenic
1083762517 11:64826469-64826491 CCCTGCAACCTCCCTAATGCAGG - Exonic
1084765426 11:71305283-71305305 CCCTGCTGCCACCTTGATTTTGG + Intergenic
1084854796 11:71976315-71976337 ACCTGCTGCCCCCTCCATTCTGG + Intronic
1085526581 11:77167543-77167565 CCCTGTTGCATCCTGAACTCTGG + Intronic
1086130159 11:83393047-83393069 CCCTCTTGCCTCCTTAAATCTGG + Intergenic
1086453574 11:86940449-86940471 CTCTGCTACCACCTTCATTCAGG + Intronic
1087922270 11:103879892-103879914 CCCTGCTGCCAACTTGATTTTGG - Intergenic
1088200935 11:107333302-107333324 ACCTCCTGGCTACTTAATTCAGG + Intronic
1088332337 11:108666569-108666591 CCCTGCTGACACCTTGATTTTGG - Intronic
1088576727 11:111279420-111279442 CCCTGCTGACACCTTGATTTTGG - Intronic
1088710743 11:112506283-112506305 GCCTGCTGACACCTTGATTCTGG - Intergenic
1090230907 11:125103029-125103051 CCCTGCTGACACCTTTATTTTGG - Intronic
1090235080 11:125141054-125141076 TCCTTCTGCCTCCTTTCTTCAGG + Intergenic
1090286287 11:125502315-125502337 CATTGCTGCATCCTTAATTTTGG - Intergenic
1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG + Exonic
1093132274 12:15406118-15406140 CTCTGATGACTCCTGAATTCTGG - Intronic
1093146768 12:15575746-15575768 CCCTGCTGACACCTTGATTTTGG - Intronic
1093902336 12:24650311-24650333 CATTGCTGCTGCCTTAATTCAGG - Intergenic
1094438865 12:30452750-30452772 CCTTGCTGACACCTTAATTTTGG + Intergenic
1094555328 12:31493974-31493996 GCCTGCTACCTCCTTACTTTGGG + Intronic
1094667490 12:32535515-32535537 CCCTGCTCCCTCCATCACTCAGG + Intronic
1095872452 12:47044984-47045006 CCCTGCTGACACCTTGATTTTGG - Intergenic
1095875095 12:47071413-47071435 CCCTCCTGCCTCCTTTTGTCTGG - Intergenic
1096069453 12:48766899-48766921 CCCTGCAACCTCCTTGACTCTGG - Exonic
1096408050 12:51358003-51358025 CCCTGCACCCTCCTTTATCCAGG - Intronic
1096531868 12:52247637-52247659 CCCTGCTCCTTCCTTAGTCCTGG + Intronic
1096655724 12:53090340-53090362 CCCTGCTGACACCTTGATTTTGG + Intergenic
1096748714 12:53745282-53745304 CTCTGGTGCCTCCTGGATTCTGG + Intergenic
1098097934 12:66979910-66979932 CCCTGCTGTCACCTTGATTTTGG + Intergenic
1099384322 12:81996773-81996795 CCCTGCTGGCACCTTAATTTTGG - Intergenic
1100402670 12:94245866-94245888 CCCTGCTGCCTACAGAATTAAGG - Intronic
1100454575 12:94740112-94740134 CACTGCTGTGGCCTTAATTCAGG - Intergenic
1100543411 12:95579217-95579239 CCCTGCCACTACCTTAATTCAGG - Intergenic
1100903984 12:99276575-99276597 CCCTGCTGCAACCTTGATTTTGG + Intronic
1101016116 12:100502349-100502371 CCCTGCTGACACCTTGATTTTGG - Intronic
1101425596 12:104585761-104585783 CCCTGCTGACACCTTGATTTTGG - Intronic
1101483813 12:105130747-105130769 CCCAGCTGCCTCCTTGACTGGGG + Intronic
1101820188 12:108178127-108178149 CCCTGCTGACACCTTAATTTTGG - Intronic
1102559276 12:113750549-113750571 CCCTGCTGACACCTTGATTTTGG - Intergenic
1102736866 12:115169768-115169790 CCGTGCTGCCTCCTTTCTCCAGG + Intergenic
1102808122 12:115799863-115799885 CCCTGCTGGCACCTTAATCTTGG + Intergenic
1103221066 12:119245952-119245974 CACTTCTGTCTCCTTAATTTAGG + Intergenic
1103300654 12:119924171-119924193 CCCTGCTGACACCTTGATTTGGG - Intergenic
1103532009 12:121608980-121609002 CCCTGCTGTCACCTTAATTTTGG + Intergenic
1103744827 12:123115290-123115312 CCCTGCTGCCTCCAATAATCTGG - Intronic
1103887034 12:124210266-124210288 CCCTGCTGACACCTTGATTTTGG - Intronic
1105436237 13:20380666-20380688 CCCTGCTGACACCTTCATTTTGG + Intergenic
1106082436 13:26511478-26511500 CCCTGCAGACACCTTAATTTTGG + Intergenic
1106158847 13:27182961-27182983 CCCTGCTGCCTTCTGAATAAAGG + Intergenic
1106229123 13:27808168-27808190 CCCTGCTCCCTCATCAGTTCAGG - Intergenic
1106260571 13:28062883-28062905 CCCTGCTGACATCTTAATTTTGG + Intronic
1106545606 13:30728264-30728286 CCCTGCTGACACCTTGATTTTGG + Intronic
1107330481 13:39294903-39294925 CCCTGCTGCTGCCTTAATTTTGG - Intergenic
1107418005 13:40219316-40219338 CACTTCTGCCTCCTTACTTCGGG - Intergenic
1107489130 13:40863635-40863657 CCTTTCTGCCTTCTTAATGCCGG + Intergenic
1107680997 13:42850402-42850424 CCCTGCTGACACCTTAATTTTGG - Intergenic
1108434842 13:50391800-50391822 CCTTCCTGCCCCCATAATTCTGG - Intronic
1108458669 13:50643030-50643052 CCCTGCTGACACCTTGATTTTGG + Intronic
1108921993 13:55687487-55687509 CACTGCTGTCACCTTAATTTTGG - Intergenic
1109957983 13:69593237-69593259 CCCTGCTGAAACCTTGATTCTGG - Intergenic
1110718605 13:78736210-78736232 CCCTACTGACACCTTAATTTTGG - Intergenic
1111430109 13:88138282-88138304 ACCTGCTGACACCTTAATTCTGG - Intergenic
1112364567 13:98745694-98745716 CCCTGCTGACCCCTTGACTCTGG + Intronic
1112369733 13:98784306-98784328 CCCTGCTGACGCCTTAATCTCGG - Intergenic
1112822256 13:103351060-103351082 CCCTACTGCCTCATTGATCCTGG - Intergenic
1114799939 14:25762052-25762074 CACTGCTTCTTCTTTAATTCAGG + Intergenic
1116065020 14:39971411-39971433 CCCTGCTGACACCCTAATTTTGG + Intergenic
1116402302 14:44522676-44522698 TCCTGCTGCCACCTTAATTTGGG + Intergenic
1116760400 14:49006084-49006106 CCCTGCTGGCACCTTGATTTTGG - Intergenic
1118213603 14:63788044-63788066 CTCTGCTGCCTCCAGAATTTGGG - Intergenic
1118851086 14:69584052-69584074 CACTGCTGCTGCCTTAGTTCAGG - Intergenic
1118988225 14:70775411-70775433 CCCTGCTGCCCCCTCCATTTGGG + Intronic
1119198650 14:72736628-72736650 CCTTTCTTCCTCCTTCATTCTGG - Intronic
1121171136 14:91855339-91855361 CCCTGCTGACTCCTTGATTTTGG - Intronic
1121211570 14:92211348-92211370 CCCTGCTGACACCTTGATTTTGG + Intergenic
1121425689 14:93850117-93850139 CCCTGCTGACACCTTGATTTTGG - Intergenic
1121468804 14:94135756-94135778 CCCTGCTGACACCTTAAATGTGG + Intergenic
1121585621 14:95061113-95061135 CCCTGCTGACGCCCTGATTCTGG - Intergenic
1122448630 14:101785361-101785383 CCCTGCTGACACCTTCATTTTGG - Intronic
1122703694 14:103607168-103607190 CCCTGCTGACACTTTGATTCCGG + Intronic
1123068337 14:105629130-105629152 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123092356 14:105747454-105747476 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123097932 14:105775155-105775177 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1202920440 14_KI270723v1_random:26284-26306 CCCTGCTGCCCGCCTTATTCTGG - Intergenic
1202924491 14_KI270724v1_random:11363-11385 CCCTGCTGCCCGCCTTATTCTGG + Intergenic
1124055212 15:26235683-26235705 CCCTGCTGCCTCCTGCACACTGG + Intergenic
1124103143 15:26713798-26713820 CACTTCTGCCTCCTTACTGCAGG + Intronic
1125446161 15:39759671-39759693 CCCTGCTGACATCTTGATTCTGG - Intronic
1126613641 15:50554439-50554461 CCTTGCTACCTTTTTAATTCAGG - Intronic
1127008381 15:54595439-54595461 CCCTGCAGCCGCCTTCCTTCAGG + Intronic
1127616340 15:60689895-60689917 CTCTGCTGCCACCTTGATTTTGG + Intronic
1127912206 15:63426644-63426666 CCCTGCTGACACCTTGATTTGGG - Intergenic
1127978369 15:64015877-64015899 CCCTGCTGACACCTTGATTTTGG + Intronic
1128810968 15:70572369-70572391 CCCTGCTGCCACCTTGATCTAGG + Intergenic
1128987268 15:72230701-72230723 CCCCTCTTCCTCCTTAAGTCTGG - Intronic
1130035274 15:80354710-80354732 CCTTGCTGACACCTTGATTCTGG + Intronic
1130679305 15:85982295-85982317 CCCTGCTGACTCCTTGGTTTTGG - Intergenic
1130830633 15:87594929-87594951 CCTCCCTGCCTCTTTAATTCTGG + Intergenic
1130938113 15:88487282-88487304 CCCTGCTGCCAACTTGATTTTGG + Intergenic
1130977285 15:88787185-88787207 CCCTGCTGACACCTTGATTTTGG - Intergenic
1131280592 15:91018189-91018211 CTCTGCTGCCTCCTCCACTCTGG + Intronic
1131564773 15:93476196-93476218 CCCTGCTGGCACCTTGATTTTGG + Intergenic
1132354995 15:101164649-101164671 CCCTGCTGACACCTTGATTTTGG + Intergenic
1132367063 15:101265379-101265401 CCCTGCTGACACCTTAAGTTTGG - Intergenic
1132384273 15:101389136-101389158 CCCTGCTGACACCTTGATCCAGG + Intronic
1133155137 16:3868991-3869013 CCATGAGGCCTCCTAAATTCTGG + Intronic
1133268098 16:4596795-4596817 CCCTGCTGACTCCTTGATTTAGG - Intronic
1133741910 16:8658285-8658307 CCCTGCTGACACCTTGATTGCGG + Intergenic
1133975782 16:10599075-10599097 CTCTACTTCCTCCTTCATTCTGG + Intergenic
1137575920 16:49600372-49600394 CCTTGCTGCCTCCATAACTTGGG - Intronic
1137798107 16:51238925-51238947 CCCTACTGCCTCAGTATTTCTGG - Intergenic
1138147445 16:54625260-54625282 CACTGCAGCCTCCTTATTCCTGG + Intergenic
1138468867 16:57215394-57215416 CCCTGGTACCTCCTAAGTTCTGG - Intronic
1138646677 16:58430651-58430673 CCCTGCTGACACCTTGATTTTGG - Intergenic
1139035327 16:62938978-62939000 TAATGCTGCCTCCTTAATGCTGG + Intergenic
1139391280 16:66607354-66607376 CCCTGCTGCCTTATTCATACAGG - Intronic
1139747151 16:69083737-69083759 CCCTGCTGCCTCTTGAGTGCTGG + Exonic
1141162854 16:81640586-81640608 CCCTGCTGACACCTTGATTTTGG - Intronic
1141315920 16:82962360-82962382 CCCTGCTGACACCTTGATTTAGG + Intronic
1141877417 16:86835453-86835475 CCCTGCTGCCTCCTTCCTTTGGG - Intergenic
1142378449 16:89718668-89718690 CCCTGCTGCTTCCTCCATGCTGG - Intronic
1142884078 17:2902028-2902050 CCCTGCTGACACCTTGATTTTGG - Intronic
1142955515 17:3518935-3518957 GCCTGCTGCCTCCTTCTCTCTGG + Intronic
1143710334 17:8730117-8730139 CAAGGCTGCCTCCTTAAATCCGG + Exonic
1143799289 17:9365338-9365360 CCCAGCTGCCCACTTAATGCAGG + Intronic
1145054991 17:19696638-19696660 CCCTGCTGACACCTTGATTTAGG + Intronic
1145072145 17:19819811-19819833 CCTTACTGCCGCCTTAGTTCAGG + Intronic
1145275984 17:21430759-21430781 CCCTGCTGACACCTTGATTCCGG + Intergenic
1147764936 17:42828140-42828162 TCCTGCTGACACCTTAATTTTGG + Intronic
1149457725 17:56801885-56801907 CCCTGCTGCCTGCTTCTTGCTGG + Intronic
1150375652 17:64679336-64679358 CCCTGCTGACACCTTGATTTTGG + Intergenic
1150438642 17:65173651-65173673 GCCTGCTGCCTCCTTATCTGCGG + Intronic
1151290357 17:73145452-73145474 ACCTGCTGACACCTTAATTTCGG - Intergenic
1152375031 17:79914547-79914569 CCCTGCTGCCTCCAGAACCCAGG - Intergenic
1153083540 18:1256507-1256529 CCCTACTGACTTCTTAAATCAGG - Intergenic
1155312603 18:24538771-24538793 CCTTGCTGCCTCCATAAATCAGG - Intergenic
1155509533 18:26562724-26562746 CCCTGCTGACACCTTAATCTTGG - Intronic
1155623885 18:27812692-27812714 CCCTGCTGACACCTTGATTTTGG + Intergenic
1156032509 18:32728949-32728971 CCCTGCTGACACCTTCATTTCGG + Intronic
1157298908 18:46465648-46465670 CCCTTCTGCCTTCTGAATTTAGG + Intergenic
1157410791 18:47461408-47461430 CCCTGCTGATACCTTAATTTGGG - Intergenic
1158500592 18:57997251-57997273 CCCTGCTGACACCTTGATTTTGG - Intergenic
1158719914 18:59915617-59915639 CCCTGCTGACACCTTGATTTTGG - Intergenic
1158963988 18:62607888-62607910 CCCTGCTGCCACCTTGATTTTGG - Intergenic
1159554566 18:69931938-69931960 CCCTGCTGGCACCTGAATTTTGG - Intronic
1159703947 18:71663642-71663664 CCCTGCTGACACCTTGATTTTGG + Intergenic
1159823508 18:73176471-73176493 CCCTGCTGACACCTTGATTTTGG + Intronic
1160804493 19:986114-986136 CCCTGCTGCCTCCTTTCTCCAGG + Intronic
1161728355 19:5943951-5943973 CCCTGCTGCCTCTTGAAGGCCGG + Intronic
1163724863 19:18917007-18917029 CCCTGCTGACACCTTGATTTGGG - Intronic
1164631899 19:29767548-29767570 CCCTGCTGCCTCCTTGCTTTAGG - Intergenic
1164828939 19:31305550-31305572 CTCTGTTGTCTCCTTAATTAAGG - Intronic
1165493162 19:36137030-36137052 CCCTGCTGCCTTTTTTTTTCTGG - Intergenic
1165987767 19:39785681-39785703 CCCTCCTCCCTCCTTAGATCTGG + Exonic
925593662 2:5534496-5534518 CCATGCTGTTCCCTTAATTCAGG + Intergenic
925859044 2:8157281-8157303 CCCTGCTGACACCTTAATCTTGG - Intergenic
926023694 2:9519805-9519827 CCCTGCTGACCCCTTGATTTTGG + Intronic
926167816 2:10532468-10532490 CCCTGCTGACACCTTGATTTTGG + Intergenic
926860123 2:17300706-17300728 CCCTGTTGCCTTCTCACTTCAGG + Intergenic
927065387 2:19465543-19465565 CCCTGCTGACACCTTGATTGTGG - Intergenic
928178293 2:29049943-29049965 CCCTGGTTCCTCCTTATTCCAGG + Intronic
929213617 2:39386267-39386289 CCCTGCTGGCACCTTAACTTTGG + Intronic
930217151 2:48708698-48708720 CCCTGCTGACACCTTGATTTTGG + Intronic
930936822 2:56963336-56963358 CCCTGCTGACTCCTTGATTTCGG - Intergenic
933777561 2:85780107-85780129 CCTTGCTGCCTCCCTAGTCCAGG - Intronic
933871225 2:86567408-86567430 CCCTGCTGACACCTTGATTTTGG - Intronic
935227339 2:101064337-101064359 CCCTGCTGGCACCTTGATCCTGG + Intronic
935494323 2:103759979-103760001 ACCTGCTGACACCTTAATTTTGG - Intergenic
935526272 2:104171730-104171752 ACCTTCTGCCTGCTTTATTCTGG - Intergenic
935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG + Intronic
937444973 2:121949967-121949989 CCCGGCTGCCCCCTGACTTCTGG - Intergenic
937688332 2:124723646-124723668 CCCTGCTGACACCTTGATCCTGG - Intronic
938122251 2:128642153-128642175 CCCTGCTGCCTTCCCAGTTCTGG - Intergenic
938376257 2:130808642-130808664 CCCTGCTGCCTCCTGGCTGCTGG + Intergenic
939236249 2:139497727-139497749 CCCTGCTGACACCTTGATTTTGG - Intergenic
939882183 2:147643039-147643061 CCCTGCTGGCACCTTGATTTCGG - Intergenic
940651894 2:156448890-156448912 TCCTGCTAACTCCTTAATTTTGG - Intronic
940824581 2:158396429-158396451 CACTGCTGTCTTCCTAATTCTGG + Intronic
941013730 2:160331105-160331127 CCCTGCTGACACCTTAATTTTGG + Intronic
942549200 2:177097042-177097064 CCCTGCTGGCACCTTGATTTTGG - Intergenic
943627999 2:190220328-190220350 CTCTGTAGCATCCTTAATTCTGG + Intronic
944447383 2:199805207-199805229 CCCTGCAGCCTCCTCAGTCCAGG + Intronic
945792808 2:214326369-214326391 CCCTGCTGACACCTTGATTTTGG + Intronic
946648586 2:221867747-221867769 TCCTGCTGCCACCTTGATTTTGG + Intergenic
946690894 2:222307398-222307420 CCCTGCTGTTTCCTTAATGCTGG + Intergenic
947376605 2:229502801-229502823 GCCTGCCGTCTCCTTATTTCAGG - Intronic
948761766 2:240196819-240196841 CCCTGCTGGCACCTTGATTTCGG + Intergenic
1168747144 20:253355-253377 CCCTGCTGGCACCTTAGCTCTGG + Intergenic
1169243435 20:4004724-4004746 CCCTGCTGACACCTTGATTTTGG + Intronic
1169895272 20:10498479-10498501 CCCTGCCTCCTGCTTATTTCAGG + Intronic
1169931030 20:10833184-10833206 CCCTCCTGCTTCCCTCATTCTGG - Intergenic
1170476732 20:16722373-16722395 CTCTGCTGCCACTTTAATTCAGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1173957839 20:47048231-47048253 CCCTGAGGTCTCCTTAATACTGG - Intronic
1173984498 20:47250554-47250576 CCCTGCTCCCTCCATACCTCAGG + Intronic
1174055206 20:47793929-47793951 CCCTGCTGGCACCTTGATTTTGG + Intergenic
1175269459 20:57723587-57723609 CCCTGCTGACACTTTAATTTTGG + Intergenic
1176519038 21:7811370-7811392 CCCTGCTGGTACCTTAATTTTGG + Intergenic
1176545531 21:8196308-8196330 CGCTGCTGCATCCTTTCTTCTGG - Intergenic
1176564482 21:8379353-8379375 CGCTGCTGCATCCTTTCTTCTGG - Intergenic
1178506493 21:33167152-33167174 CCCTGCTGACACCTTGATTTTGG + Intronic
1178653066 21:34441383-34441405 CCCTGCTGGTACCTTAATTTTGG + Intergenic
1178704551 21:34862493-34862515 CCCTGCTGCCACCTTGATTTGGG - Intronic
1179062812 21:37995322-37995344 CCCTGCTGACACCTTAATTTTGG - Intronic
1181925369 22:26354427-26354449 CCCTGCTGACACCTTGATTTTGG + Intronic
1182962707 22:34490532-34490554 CCCTGCTGACACCTTGATTTTGG + Intergenic
1183312087 22:37115719-37115741 CCCTGCTGCCACCTTGAGTTTGG - Intergenic
1184164303 22:42718842-42718864 CCCAGCTGCCTCCTTCTTTGGGG - Intronic
1184370712 22:44080321-44080343 CCCTGCTGCCACCTTGATGTTGG - Intronic
1184605089 22:45568339-45568361 CCCTGCTGACACCTTGATTTTGG - Intronic
1184978192 22:48078074-48078096 CCCTGCTGGCACCTTGATTTTGG - Intergenic
1185093666 22:48792799-48792821 CCCTGCTGACAACTTGATTCAGG - Intronic
1203250401 22_KI270733v1_random:112545-112567 CGCTGCTGCATCCTTTCTTCTGG - Intergenic
949142204 3:648200-648222 CCCTACAGCCACCTTGATTCTGG - Intergenic
949848503 3:8397302-8397324 CCCTGCTGCCTCATTCAATATGG - Intergenic
949889554 3:8723654-8723676 CCATGTTGCTTCCTTTATTCTGG + Intronic
950059469 3:10058015-10058037 CCTTTCTGCCTTCTTAATTCCGG + Intronic
950138081 3:10596838-10596860 CCCTGCAGCCTCCTTCGTTTGGG - Intronic
950361360 3:12451717-12451739 CCCTGCTGCCACCTTGATCTTGG + Intergenic
950798688 3:15531956-15531978 CCCTCCTCCCTCCTTCCTTCAGG + Intergenic
950978481 3:17276122-17276144 CTCTGCTGCCACCTTTATCCTGG - Intronic
950984117 3:17342031-17342053 CCCTGCTGCCATCTTATTTAGGG + Intronic
952290153 3:32007446-32007468 CCCTGCTGGCACCTTGATTTTGG - Intronic
952328978 3:32346478-32346500 CCCTGCTGTCCCCTTAATCTTGG - Intronic
952719086 3:36513819-36513841 CCTCTCTCCCTCCTTAATTCTGG - Intronic
953364232 3:42328513-42328535 CCCTGCTGACACCTTGATTTAGG - Intergenic
953446418 3:42972402-42972424 CCCTGCTGTCACCTTGATTTTGG - Intronic
954731945 3:52671400-52671422 CTCTGCTGCCTCCTTTTTGCTGG - Intronic
956559912 3:70564426-70564448 TCCTGCTGCCACCTTCATTAGGG - Intergenic
956658757 3:71580107-71580129 CTCTCCTGCTTCCTTAATTTGGG + Intronic
956801066 3:72758885-72758907 ACCTGCTGACTCCTTAATTCTGG - Intronic
957081144 3:75636803-75636825 CCCCGCTGCCTGCCTGATTCTGG + Intergenic
959019866 3:101177342-101177364 CCCTGCTGACACCTTAATTCTGG - Intergenic
959514171 3:107246800-107246822 CCCTTCTGCCAACTTTATTCTGG - Intergenic
960370481 3:116831328-116831350 CCCTCCTGATTCCTTGATTCTGG + Intronic
960706011 3:120481886-120481908 CCTAGATGCTTCCTTAATTCAGG + Intergenic
962452954 3:135536869-135536891 ACTTGCAGCCTCCTTAATCCAGG + Intergenic
962643338 3:137411416-137411438 CCCTGCTGACACCTTCATTTTGG - Intergenic
962686822 3:137855988-137856010 CCCTGCTGACACCTTGATTTCGG - Intergenic
963083619 3:141416896-141416918 CCCTGCTGACTCCTTGATTTTGG + Intronic
963970334 3:151422337-151422359 CCCTGCTGACACCTTAATCTTGG - Intronic
964621590 3:158724579-158724601 CCCTGCAGACACCTTAATTTTGG + Intronic
966788711 3:183644440-183644462 GCCTGCTGCCTCCTGACTTTTGG - Intronic
966940603 3:184744240-184744262 CCCTGCTGCCCACCCAATTCTGG - Intergenic
967934964 3:194719762-194719784 CCCTGCTGACACCTTGATTTTGG + Intergenic
968213724 3:196869968-196869990 CCTTTCTGCCTCCTTCATCCTGG + Intronic
969079337 4:4606425-4606447 CTCTGCTGACACCTTGATTCTGG - Intergenic
969150441 4:5164581-5164603 CCATGCTGCCACCTTAATGTGGG - Intronic
969528831 4:7718316-7718338 CCCTGCTGCCTCCTTCAGTCTGG - Intronic
969577257 4:8043658-8043680 CCCTGCTGACTCCTTGATCCTGG + Intronic
969978781 4:11132753-11132775 CCCTGCTGACACCTTGATTTTGG - Intergenic
970027073 4:11635028-11635050 CCCTGCTGACACCTTAATCTTGG - Intergenic
970488466 4:16547672-16547694 CACTGCTGCCTCTATAATTAGGG - Intronic
971418178 4:26452661-26452683 CCCTGATGCATCCTCCATTCCGG - Intergenic
973127370 4:46604302-46604324 CCCTTCTGTGTCCTTGATTCAGG - Intergenic
975574348 4:75848115-75848137 CACAGGTCCCTCCTTAATTCTGG - Intergenic
977803286 4:101264862-101264884 CCCTGCTACCTCCTTTAATAAGG - Intronic
977917795 4:102613315-102613337 CCATGCTGCCTCCTCCACTCAGG - Intronic
978406461 4:108384536-108384558 CTCTTCTGACTCCATAATTCTGG + Intergenic
978470732 4:109064608-109064630 TCCTGCTGTCTTCTTAGTTCAGG - Intronic
978660827 4:111124108-111124130 ACCTGCTGGCACCTTAATTTTGG + Intergenic
978750395 4:112239641-112239663 CGCTGCTGCCACATTAATCCAGG + Intronic
978835101 4:113139809-113139831 CACTGCTGCCTCTTGACTTCTGG - Intronic
979289109 4:118960159-118960181 CCCTGCTGACACCTTGATTTTGG + Intronic
980083129 4:128365260-128365282 CCCTGCTGACACCTTGATTTTGG - Intergenic
981497670 4:145411991-145412013 TCCTGCTGGCACCTTAATTTTGG + Intergenic
981527358 4:145720088-145720110 ACCTGTTGCCACCTTCATTCTGG - Intronic
983911514 4:173244715-173244737 CACTGCTACTGCCTTAATTCAGG - Intronic
984356742 4:178669772-178669794 CCCTGCTGACACCTTGATTGTGG - Intergenic
985090264 4:186355383-186355405 CCCAGCTGCCACCTTGATTTTGG - Intergenic
985241175 4:187932320-187932342 CCCTGCTGACTCCTTGATCTTGG + Intergenic
985857616 5:2442437-2442459 CCATGCTGCCTTTTTGATTCTGG - Intergenic
986224708 5:5801834-5801856 CCCTGCTGACACCTTGATTTTGG - Intergenic
986673873 5:10167108-10167130 CCCTGCTGACACCTTGAATCTGG + Intergenic
986762305 5:10891333-10891355 CCCTGCTGCCACCTTGATCTTGG + Intergenic
987825142 5:23021253-23021275 CCCTGCTGCCACTTTGATTTTGG + Intergenic
988282468 5:29167722-29167744 CCCTGCTGGCACCTTGATCCTGG + Intergenic
988865669 5:35331721-35331743 CCCTGCTGGCACCTTGATTTTGG + Intergenic
988873086 5:35412553-35412575 CCCTGCTGACACCTAAATTTTGG - Intergenic
989294470 5:39807627-39807649 CATTGCTGCCTCCTGGATTCTGG - Intergenic
989609603 5:43278438-43278460 TTTTGCTGCCTCCTTAATTTTGG + Intronic
989729681 5:44633713-44633735 CCCTGCTGACACCTTGATTTTGG + Intergenic
990442496 5:55860886-55860908 CCCTGCTGCCACCTTGACACTGG - Intronic
992464225 5:76987915-76987937 CCCTGCTGACACCTTGGTTCTGG + Intergenic
993702009 5:91130014-91130036 CCTTGCTGCCTCCCTGATTTTGG + Intronic
995777281 5:115737547-115737569 CCCTGCATCCTCCTTCCTTCTGG + Intergenic
996810875 5:127515245-127515267 CCCTGCTGACACCTTGATTTTGG + Intergenic
997300606 5:132801220-132801242 CCCTGTTGACACCTTAATTGGGG - Intronic
998225930 5:140326206-140326228 CTCTGCTACCACCCTAATTCTGG + Intergenic
998303112 5:141045581-141045603 CCCTGCTGACTTCTTGATTTTGG - Intergenic
998649918 5:144106946-144106968 CCCTGCTGACACCTTAATTTTGG + Intergenic
999756513 5:154668609-154668631 CTCTGCTACCACCTTAATTTTGG - Intergenic
1000050131 5:157555791-157555813 CCCTGCTGACCCCTTGATTTTGG - Intronic
1000627578 5:163556842-163556864 CCCTGCTGACACCTTGATTTTGG + Intergenic
1001543681 5:172556977-172556999 CCCTTCTCCCGCCTTCATTCAGG - Intergenic
1001798594 5:174523593-174523615 CCCAGTTGCTGCCTTAATTCTGG - Intergenic
1001913097 5:175537184-175537206 CCCTGCGGCGTGCTTTATTCCGG + Intergenic
1002099103 5:176848607-176848629 CCCTGCTGCCACCTTCCATCTGG - Intronic
1002208452 5:177580596-177580618 CCCTGCTGTCACCTTGATTTTGG + Intergenic
1002558518 5:180063264-180063286 CACGGCTGCCGCCTTAGTTCAGG - Intronic
1002968634 6:1992036-1992058 CCCTGCTGACACCTTAGTTTTGG + Intronic
1003007925 6:2398618-2398640 CTCTGCTGCCTCCGTCACTCTGG - Intergenic
1003124435 6:3344809-3344831 ACCTGCTGCCTCCTTAAAATGGG + Intronic
1003644321 6:7902180-7902202 CCCTGCTGGCTCCTTGATTTAGG + Intronic
1004024334 6:11804650-11804672 CCCTGCTGTCTCCTTCCTTCTGG + Intronic
1004603612 6:17174016-17174038 CTCTGCTGACACCTTAATTTTGG + Intergenic
1004775367 6:18838124-18838146 CCCTGCTGACACCTTGATTTTGG + Intergenic
1006323980 6:33339191-33339213 CCCTGGTGCCTCATTCATTATGG - Intergenic
1008642170 6:53475235-53475257 CCCTGCTGACACCTTGATTTTGG - Intergenic
1008833458 6:55797993-55798015 CCCTGCTGACACCTTGATTTTGG - Intronic
1009672376 6:66772954-66772976 CTCAGCTGCCTCCTTATCTCTGG + Intergenic
1013968347 6:115983668-115983690 TCTTCCTGCCTTCTTAATTCTGG + Intronic
1014239007 6:118993991-118994013 CCCTGATGACACCTTTATTCTGG - Intronic
1015414672 6:132934712-132934734 CCCTGCTGACACCTTGATTTAGG + Intergenic
1015597727 6:134881618-134881640 CCCTGCTGGCACCTTGATTGTGG - Intergenic
1015641721 6:135340810-135340832 CCCTTCTGCCTCCTTTGTGCTGG - Intronic
1016207537 6:141487717-141487739 CCCTGCTGGCTCCTTGCTTTTGG + Intergenic
1016335760 6:143003252-143003274 CCCTGTTGCCTCCTTGGTTCTGG - Intergenic
1016381982 6:143493631-143493653 CCCTGCTGACGCCTTGATTTTGG - Intergenic
1016779798 6:147944784-147944806 CCCTGCTGACACCTTAATCGTGG - Intergenic
1017293641 6:152769833-152769855 TCCTTGTGACTCCTTAATTCTGG - Intergenic
1017479808 6:154841248-154841270 CCCTGCTGACACCTTGATTTTGG - Intronic
1017909781 6:158782765-158782787 TCCTTCTGCCTCTTAAATTCAGG + Intronic
1018435334 6:163753887-163753909 CCCTGCTGACACCTTGATCCTGG - Intergenic
1019852846 7:3576779-3576801 TCCTGATGCTTCCTTGATTCAGG + Intronic
1019931051 7:4223412-4223434 CCCTGCTGCCACCTTGACTGTGG - Intronic
1020558524 7:9699530-9699552 CCCTGCTGACACCTTAATTCTGG + Intergenic
1021234636 7:18127445-18127467 CCCTGCTCCCTCTGTACTTCTGG + Intronic
1021961267 7:25875376-25875398 CTCTGCTGACTCCTTCATTCTGG - Intergenic
1022774623 7:33513126-33513148 CCCGGCTACCCCCTTCATTCTGG + Intronic
1023113137 7:36834389-36834411 CCCTGCTGACACCTTGATTTTGG + Intergenic
1024000667 7:45187389-45187411 CCCTCCTGCCTCCTCAAATTGGG - Intergenic
1024377136 7:48652758-48652780 CCCTGCTAACACCTTAATTTTGG - Intergenic
1024492948 7:50007030-50007052 CCCTTCAGCCTCCTTTATTAGGG - Intronic
1025237779 7:57246198-57246220 CCCTGCTGGCACCTTGATTTTGG - Intergenic
1025733744 7:64128842-64128864 CCCTGCTGACACCTTGATCCTGG + Intronic
1026613424 7:71881031-71881053 TCCTTCTGCCTGCTTTATTCTGG - Intronic
1028636254 7:92992927-92992949 ACCTGCGGCCTCCTTCATTATGG - Intergenic
1030311283 7:108071737-108071759 CCCTGCCACTTCCCTAATTCAGG + Intronic
1031144845 7:117986293-117986315 CCCTGCTGACACCTTGATTTGGG - Intergenic
1031357484 7:120804982-120805004 CCCTGCTGACACCTTAATCTTGG + Intronic
1031724745 7:125223773-125223795 CCCTGCTGACACCTTGATTTTGG + Intergenic
1032172955 7:129600948-129600970 TCCTGCTGCCTCTTGAATTCTGG + Intergenic
1032599131 7:133274417-133274439 CCCTGCAGCTGCCTTACTTCAGG - Intronic
1032687609 7:134251427-134251449 CCCTGCTGACACCTTGATTTTGG + Intronic
1035148511 7:156844793-156844815 CCATGCTGCCTCCTTCTTCCAGG - Intronic
1035313474 7:157984111-157984133 CCCAGCAGCCTTCTTTATTCTGG + Intronic
1035467289 7:159087984-159088006 CCCTGCTGCCCCCATAATCCAGG + Intronic
1036921188 8:12856833-12856855 CCCTGCTGTCTCCCTAATGATGG - Intergenic
1037002029 8:13731711-13731733 CCCTGCTGCCTCTTTTATAAGGG - Intergenic
1037122111 8:15301178-15301200 CCATGCTGCCTTCTTGTTTCTGG - Intergenic
1037530215 8:19765641-19765663 TGCTTCTGCCTGCTTAATTCTGG - Intergenic
1038094920 8:24297693-24297715 CCCTGCTGCCTCCTTAATTCAGG - Intronic
1038417236 8:27406022-27406044 CCCTGCTGACACCTTGATTTAGG - Intronic
1039485870 8:37909360-37909382 CCCTGCTGACACCTTCATTCTGG + Intergenic
1039492644 8:37959428-37959450 CCCTGCTGCCACCTTGATTTTGG + Intergenic
1039780040 8:40776007-40776029 CCCTGCTGCCACCTTGATCATGG + Intronic
1039865855 8:41500839-41500861 CCCTGCTCCCTTCCTAATCCAGG - Intronic
1040800067 8:51330567-51330589 CCCTGCTGGCACCTTGATTTTGG - Intronic
1041114952 8:54526546-54526568 GCCTGCTGCATCCTTCTTTCCGG - Intergenic
1041567043 8:59290465-59290487 CCCTGCTGCCACCTTAATCTTGG - Intergenic
1041704328 8:60829877-60829899 CTCTGCTGGCTCCTTAGTGCAGG + Intronic
1041721052 8:60975614-60975636 CCCTGCTGACACCTTAATTTTGG + Intergenic
1041731944 8:61071292-61071314 CCCTGCTGACACCTTGATTTCGG - Intronic
1042154400 8:65826798-65826820 TCCTGCTGACTCCTTGATTTTGG - Intronic
1042295758 8:67215727-67215749 CCCTGCTAACTCCTTGATTTAGG + Intronic
1043245795 8:77999231-77999253 CCCTGCTGACTTCTTGATTTTGG - Intergenic
1043352182 8:79374707-79374729 CCCTGCTGACACCTTGATTTTGG - Intergenic
1043417959 8:80071089-80071111 CCTTGCTGCCTCCTCGCTTCTGG - Intronic
1044647108 8:94455674-94455696 CCCTGCTGCCACCTTGATTTTGG - Intronic
1044959297 8:97514945-97514967 CCCTGCTGACAACTTAATTTTGG - Intergenic
1045935942 8:107678970-107678992 CCCTGCTGACTCCTGAATTTGGG - Intergenic
1046069980 8:109239222-109239244 CCCTGCTGACACCTTGATTTTGG - Intergenic
1046297758 8:112244024-112244046 TCCTGCTGACACCTTAATTTTGG + Intronic
1046661826 8:116955849-116955871 CCCTGCTGACTCCTTGATTTTGG + Intronic
1046780853 8:118213221-118213243 CCCTCCTGCTTCCTTGAATCTGG + Intronic
1046859301 8:119072075-119072097 CACTGCTGCCTCCTTCACTAAGG + Intronic
1047763152 8:127968962-127968984 CCCTGCTGTCCCCTTGATTTTGG + Intergenic
1049060201 8:140270695-140270717 CCCTCCTGCCTCCTCAGCTCCGG - Intronic
1049363788 8:142226756-142226778 CCCTGCTGCTTCCTTATGCCGGG - Intronic
1049576763 8:143393292-143393314 CCCTGCTCCCTCCTTCTCTCTGG + Intergenic
1051247712 9:15128426-15128448 CCCTGCTGACACCTTGATTTTGG + Intergenic
1051432892 9:16998604-16998626 CCCAGCTGACACCTTCATTCTGG + Intergenic
1053241597 9:36500064-36500086 CCCTGCTGACACCTTGATTTTGG - Intergenic
1053527208 9:38842208-38842230 CCCTGCTGTCACCTGACTTCAGG + Intergenic
1054199431 9:62066639-62066661 CCCTGCTGTCACCTGACTTCAGG + Intergenic
1054638924 9:67521718-67521740 CCCTGCTGTCACCTGACTTCAGG - Intergenic
1055618695 9:78100175-78100197 CCCTGCTGGCACCTTAATTTTGG + Intergenic
1056967631 9:91178391-91178413 CCCTGCTGGCTGCTGAGTTCTGG - Intergenic
1057053406 9:91942867-91942889 CCCTGCCGCCACCTTGATTTTGG + Intronic
1057744964 9:97743898-97743920 CCCTGCTGGCACCTTGATTTGGG + Intergenic
1057860162 9:98634620-98634642 CCCTGCTGACACCTTAATTTTGG + Intronic
1058071652 9:100607424-100607446 CCCCCCTGCCTCCTAAATGCTGG - Intergenic
1059418445 9:114176212-114176234 CCCTGCTTTTTCTTTAATTCTGG + Intronic
1060041919 9:120307513-120307535 CCCTGCTGACACCTTGATTTTGG + Intergenic
1061351018 9:130064938-130064960 CCCTGCTGACGCCTTGATTTTGG + Intronic
1061405837 9:130392593-130392615 ACCTCCTGCCTCCCAAATTCGGG - Intronic
1061995449 9:134180705-134180727 CCCTGCTGCCTCCTCCCTGCAGG + Intergenic
1062320947 9:135990303-135990325 CCCTGCAGGCTCCTGGATTCCGG + Intergenic
1203466803 Un_GL000220v1:95817-95839 CGCTGCTGCGTCCTTTCTTCTGG - Intergenic
1187270363 X:17775183-17775205 TCCAGCTTCCTCCTGAATTCAGG + Intergenic
1187320145 X:18230525-18230547 TCCAGCTTCCTCCTGAATTCAGG - Intergenic
1189173634 X:38932773-38932795 CTCTGCTGCATCCTCAATCCTGG + Intergenic
1189355217 X:40305266-40305288 CCCTGCTGCCCCCTTACCCCAGG + Intergenic
1190146429 X:47895517-47895539 CCCTGCTGACACCTTGATTTTGG + Intronic
1190228296 X:48562285-48562307 CCCTGATGCCTCCTCATCTCTGG - Exonic
1190372220 X:49753627-49753649 CCCTGCTGACACCTTGATTTTGG + Intergenic
1190427654 X:50347724-50347746 AGCTGCTGCCTCCTTACTCCTGG + Exonic
1190617479 X:52250763-52250785 CCCTGCTTCCTTCTTGAGTCTGG + Intergenic
1190741190 X:53289761-53289783 CCCTACAGCCTCCTTGACTCTGG + Intronic
1190766788 X:53481785-53481807 CCCTGCACCCACCTTAGTTCAGG + Intergenic
1192498429 X:71632311-71632333 CCCTGCTGACACCTTGATTTTGG - Intergenic
1193518062 X:82494637-82494659 CCCTCCTGGCACCTTAATTTTGG - Intergenic
1194265265 X:91745304-91745326 CCCTGATGACACCTTAATTTTGG + Intergenic
1194294389 X:92110421-92110443 CCCGGGTGCATCCTTAATTTTGG - Intronic
1194632463 X:96302279-96302301 CCCTACTGACACCTTAATTTTGG + Intergenic
1195861087 X:109384087-109384109 CCATACTGCCTCCTTAATCATGG + Intronic
1196529376 X:116766444-116766466 TCCAGCTGCCTCCTTGTTTCTGG + Intergenic
1196711544 X:118768845-118768867 CCCTGCTGACACCTTCATTTTGG + Intronic
1197641623 X:128974500-128974522 CCCTTCTGCCTCTTGTATTCTGG - Intergenic
1198012173 X:132568616-132568638 CCCTGATGCCACCTTAATTTGGG + Intergenic
1198211335 X:134519142-134519164 CCTTGCTTCCTCCTAGATTCTGG + Intronic
1198256717 X:134930554-134930576 CCCTACTACCACTTTAATTCAGG + Intergenic
1199617447 X:149668892-149668914 CCTTGCTGCCTCCAAAACTCTGG - Intergenic
1199625196 X:149734357-149734379 CCTTGCTGCCTCCAAAACTCTGG + Intergenic
1199734134 X:150668204-150668226 CCCTGCTGACACCCTAATTTGGG + Intronic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1200204019 X:154302979-154303001 CCCTGCTGCCACCTGGATTCTGG + Intronic
1200227134 X:154424432-154424454 CCCTGGTGCCACCTTGATTTCGG - Intergenic
1200582417 Y:4965752-4965774 CCCTGATGACACCTTAATTTTGG + Intergenic
1200611897 Y:5334939-5334961 CCCGGGTGCATCCTTAATTTTGG - Intronic
1202099181 Y:21287978-21288000 CCCTGCTGCCTCCCTAGCACAGG + Intergenic