ID: 1038097511

View in Genome Browser
Species Human (GRCh38)
Location 8:24331296-24331318
Sequence TGGGAGAGGACTGTGATTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 481}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038097499_1038097511 26 Left 1038097499 8:24331247-24331269 CCTACAGATATCATATCCACTCC 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG 0: 1
1: 0
2: 1
3: 68
4: 481
1038097508_1038097511 -9 Left 1038097508 8:24331282-24331304 CCAGTTGGTGGAAATGGGAGAGG 0: 1
1: 1
2: 4
3: 21
4: 239
Right 1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG 0: 1
1: 0
2: 1
3: 68
4: 481
1038097504_1038097511 5 Left 1038097504 8:24331268-24331290 CCAATTTGTGGGAACCAGTTGGT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG 0: 1
1: 0
2: 1
3: 68
4: 481
1038097502_1038097511 10 Left 1038097502 8:24331263-24331285 CCACTCCAATTTGTGGGAACCAG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG 0: 1
1: 0
2: 1
3: 68
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038097511 Original CRISPR TGGGAGAGGACTGTGATTGT GGG Exonic
902896427 1:19483680-19483702 TGGGTGAGGACTTTGAAAGTGGG - Intronic
903497493 1:23779364-23779386 TGGGAGATGCCTGAAATTGTAGG + Intronic
903850543 1:26303158-26303180 TGGGAAAGTACTGTGAGGGTGGG + Intronic
905643544 1:39608965-39608987 TGGAAGAGGACTGGGAGTGCTGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907470788 1:54672135-54672157 TTGGAGAAGACTGGGGTTGTGGG + Intronic
907612901 1:55890354-55890376 TGAGGGAGGACTGTGAATGGAGG - Intergenic
907909856 1:58816191-58816213 TGGGAGAAGACTGAGATTTCTGG + Intergenic
908336825 1:63134433-63134455 TGGGAGAGAACTGTGATACCAGG + Intergenic
909472124 1:76040626-76040648 AGGGAGAGGACTGTGCTTACTGG + Intergenic
909505134 1:76379657-76379679 TGGGAGAGGCCTGTTTTTCTGGG - Intronic
909673560 1:78214413-78214435 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911046297 1:93631509-93631531 TGGCAGAGGACAGTGACTATTGG + Intronic
911317863 1:96376534-96376556 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
911678920 1:100691832-100691854 TGGGTGAGGCCAGTGACTGTTGG - Intergenic
912230564 1:107787950-107787972 AAGGAGAGGAGTGGGATTGTGGG - Intronic
912496748 1:110096746-110096768 TGGGAGAAGACTGACATTTTTGG - Intergenic
912616171 1:111102197-111102219 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
914927145 1:151898291-151898313 TGGGTGAGGCCTGTGACTGCCGG + Intronic
914967944 1:152277870-152277892 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916263726 1:162869068-162869090 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
916371620 1:164102416-164102438 TAGGAGTGGACTGTGGTTGAAGG - Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917461561 1:175234770-175234792 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919277887 1:195444861-195444883 TGGGTGAGGTCTGTGACTGCTGG + Intergenic
919428965 1:197469413-197469435 TGGGCCAGGATTGTGACTGTGGG + Intronic
919549507 1:198966649-198966671 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
920299131 1:204977733-204977755 TGGCAGGGGACTGTGATTAGTGG - Intronic
920872231 1:209804704-209804726 TGGGAGAGGACAGTTATGCTCGG - Intronic
921958244 1:221006388-221006410 TGAGAGAGGAGTGTGAATGATGG + Intergenic
922146512 1:222950644-222950666 TGGGAGCGGAGGGTCATTGTGGG + Intronic
922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG + Intergenic
922396086 1:225202478-225202500 TGGGTGAGGCCTGTGACTGCTGG - Intronic
922531565 1:226349134-226349156 TGGGAGAGGACAGTGCTTTGTGG + Intergenic
924321436 1:242854939-242854961 TGGGTGAGGACTGTGACTGCTGG - Intergenic
924883304 1:248187017-248187039 TGGGTGAGGCCCGTGATTGCTGG - Intergenic
1064130829 10:12708227-12708249 TGGGAGTGCACTGTCATTGCAGG - Intronic
1064523906 10:16232831-16232853 TGAGAGAGGACTTTGAGTTTTGG - Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065916573 10:30358445-30358467 TGGGAGAGGCCAGTGTGTGTAGG + Intronic
1067263193 10:44712641-44712663 TGGGACAGGAAAGAGATTGTTGG + Intergenic
1067552447 10:47245271-47245293 TGGGACACGACTGTGAGTGGAGG - Intergenic
1069037390 10:63659762-63659784 TGGGAGAGGGGTGTGGTTATGGG - Intergenic
1069566086 10:69464400-69464422 TGGGGGAGGAGTGAGACTGTGGG + Intronic
1073577423 10:104638545-104638567 TGGAAGAAGACTGTAATTGATGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074701896 10:116099589-116099611 TGTTAGAGGATTGTGATGGTAGG - Intronic
1074985834 10:118658812-118658834 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1075397816 10:122140743-122140765 TGGGAGCTGACTGGGGTTGTTGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1075946783 10:126440244-126440266 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1076193998 10:128502306-128502328 TGAGAGGAGACAGTGATTGTAGG - Intergenic
1077726430 11:4679521-4679543 TAGAAGAGGACTGAGATTGTGGG + Intergenic
1078288570 11:9983283-9983305 TGGGTGAGGCCTGTGACTGCCGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080672565 11:34394863-34394885 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081282497 11:41226975-41226997 AAGCAGAGGACTGTGGTTGTGGG - Intronic
1081797196 11:45828859-45828881 TGGGAGAGGGCTGTGCTGGCAGG + Intergenic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1082916837 11:58446502-58446524 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1082976772 11:59080445-59080467 TGTGAGAGACCTGTGATTCTAGG - Intergenic
1083333532 11:61910214-61910236 TGGGTGCGGAGTGTGAGTGTTGG + Intronic
1083528556 11:63395991-63396013 TGGGTGAGGCCTGTGACTGTGGG - Intronic
1085747797 11:79129588-79129610 TGGGTGAGGCCTGTGATTGCTGG + Intronic
1085917139 11:80903345-80903367 TGGGCGAGGCCTGTGACTGCTGG + Intergenic
1085979419 11:81705556-81705578 TGTCAGAGAACTGTGGTTGTGGG - Intergenic
1087688958 11:101297579-101297601 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1088179453 11:107092592-107092614 TGGGTGAGGCCTGTGACTGTCGG + Intergenic
1088239503 11:107758892-107758914 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1088372477 11:109106762-109106784 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1088850131 11:113697444-113697466 TGGGAGAGGATGGTGGTGGTAGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089618659 11:119709673-119709695 TGGGAGAGGAGAGTGATGCTCGG + Intronic
1089826404 11:121281835-121281857 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1090534239 11:127623430-127623452 TGAGAGAGGACTGAGGTTGGAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092693633 12:11144376-11144398 TGGGTGAGACCTGTGACTGTTGG - Intronic
1093409292 12:18845376-18845398 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1093699031 12:22196915-22196937 TGGGAGAGGACAGAGACTGACGG + Exonic
1093720547 12:22437304-22437326 TGGGTGAGGTCTGTGACTGCCGG + Intergenic
1093994927 12:25631007-25631029 TGGGTGAGGCCTGTGACTGCCGG + Intronic
1094362084 12:29640945-29640967 TGGGTGAGGCCTGTGACTGCCGG + Intronic
1094447374 12:30546313-30546335 TGTGTGAGGCCTGTGATTGCTGG - Intergenic
1095118512 12:38385167-38385189 TGGGTGAGGCCTGTGACTGCAGG - Intergenic
1095732668 12:45522309-45522331 TGGGCGAGGCCTGTGACTGCCGG + Intergenic
1095932059 12:47637044-47637066 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1097295466 12:57958087-57958109 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1097534624 12:60851574-60851596 TAGGAGAGAAATGTGATTGGAGG + Intergenic
1097981351 12:65741032-65741054 AGGGAGAGGACTGGGAATGTTGG - Intergenic
1099393029 12:82103138-82103160 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1099473039 12:83074626-83074648 TGGGTGAGGCCTGTGACTGCTGG - Intronic
1099777441 12:87151457-87151479 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1100203620 12:92325537-92325559 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1101635292 12:106535556-106535578 TGGGTGAGGGCTGTGACTGCTGG - Intronic
1101717812 12:107326289-107326311 TGGGAGAGGAGTGGGGTTGGAGG + Intronic
1102866178 12:116376920-116376942 TGGGAGAGGGACGTGATTGGAGG + Intergenic
1104657990 12:130588122-130588144 TTGGAGAGGAGTTGGATTGTTGG - Intronic
1105930742 13:25049355-25049377 TGGGTGAGGACTGTGTCTGCTGG + Intergenic
1106528645 13:30567047-30567069 TGGTAGAGAACTGTGACTTTAGG - Intronic
1106938169 13:34747356-34747378 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1108817074 13:54305257-54305279 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1109614625 13:64814707-64814729 TGGGAGAGGACTAAAAATGTAGG + Intergenic
1109882525 13:68499051-68499073 TGGGAGAGATCTGCCATTGTCGG - Intergenic
1110204438 13:72895979-72896001 TGGGTGAGGCCTGTGACTGTTGG + Intronic
1110454074 13:75670147-75670169 TAGGAGAGAACTTCGATTGTTGG + Intronic
1110561842 13:76917957-76917979 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1110661229 13:78061078-78061100 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111748529 13:92298108-92298130 TGGGTGAGGCCTGTGAGTGCTGG - Intronic
1112086971 13:96041726-96041748 TGGGTGAGGCCTGTGACTGTAGG + Intronic
1113040423 13:106098974-106098996 TGTGAGAGGAATGTGTTTGTAGG - Intergenic
1113585481 13:111461577-111461599 TGGGCGAGCACTGTGTCTGTGGG + Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116521420 14:45851892-45851914 TGGGAAAGGACCCTGATGGTAGG + Intergenic
1117112744 14:52475524-52475546 TGGGTGAGGCCTGTGACTGCCGG + Intronic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117510810 14:56448926-56448948 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118532230 14:66718993-66719015 TGGGTGAGGCCTGTGACTGCCGG - Intronic
1121044172 14:90775765-90775787 TGGGAGATGACTGTGCTGGTGGG + Intronic
1121516628 14:94556516-94556538 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1122665216 14:103325031-103325053 TGTCAGAGGACTGCTATTGTGGG + Intergenic
1122711789 14:103663792-103663814 TGGGACAGGATTGAGGTTGTCGG + Intronic
1123923084 15:25084273-25084295 TGGGATGGGAATGTAATTGTAGG + Intergenic
1123923992 15:25090606-25090628 TGGGACAGGAATGTGATTGCGGG + Intergenic
1125167448 15:36724557-36724579 TGGGAGAGGAATGTGAGTGATGG + Intronic
1125222531 15:37355723-37355745 TGGGAGAGGACTCTGTTAGGTGG + Intergenic
1125271505 15:37943737-37943759 GGAAAGAGTACTGTGATTGTAGG - Intronic
1125421857 15:39511991-39512013 TGGTGGAGGGCTGTGATTGATGG - Intergenic
1126154025 15:45548434-45548456 TGGGAGAAGCCTATGAGTGTAGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127194446 15:56568747-56568769 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1127899087 15:63328039-63328061 TGGGTGATCACTGTGATTCTTGG - Intronic
1128354949 15:66919584-66919606 TGGGAAAGGACTGTGGCTGCTGG - Intergenic
1128414997 15:67436755-67436777 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1128719902 15:69940577-69940599 TGGGGGAGGGCTGTGGTGGTGGG - Intergenic
1129079000 15:73023180-73023202 TGAGTGGGGACTGTGATTGAAGG + Intergenic
1129210417 15:74064904-74064926 TGGGAGAGGCCAGTGTGTGTGGG + Intergenic
1129403597 15:75300469-75300491 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1129605909 15:77024918-77024940 GGAGAGAGGGCTGTGAATGTGGG + Intronic
1130485467 15:84396031-84396053 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1131326866 15:91456304-91456326 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1131471683 15:92703253-92703275 TGGGAGGGGACTGGGATCCTGGG - Intronic
1132210313 15:100017153-100017175 TGGGTGAGGCCTGTGACTGCCGG - Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135901564 16:26464758-26464780 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1138880993 16:61014757-61014779 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1139286744 16:65821992-65822014 AGGGAAAGGACTGTGAGTTTAGG + Intergenic
1140546702 16:75816735-75816757 TGGTATAGGACTTTGAATGTTGG + Intergenic
1141180806 16:81752362-81752384 AGGGAGGGGACTGTGAGGGTTGG + Intronic
1143158330 17:4852970-4852992 TGGTGGAGGAGTGTGATTGATGG + Intronic
1143179123 17:4973434-4973456 TGGGAGAGGACTTATATTTTGGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143427883 17:6854332-6854354 TGGGGGAGGCCTGTGACTGCCGG + Intergenic
1143626868 17:8115311-8115333 TGAGAAAGGACTGAGATTGGTGG + Intronic
1144139709 17:12336676-12336698 TGGGTGAGGCCTGTGACTGTTGG - Intergenic
1144463952 17:15481578-15481600 TGGGAAAAGACTGTGGTTCTAGG - Intronic
1145011703 17:19372003-19372025 TGGGAGGGGCCTCTGTTTGTAGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146583370 17:34059697-34059719 TGGGTGAGGCCTGTGACTGCCGG + Intronic
1147463213 17:40589228-40589250 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1147517860 17:41139148-41139170 TAAGAGAGGAGTGAGATTGTAGG + Intergenic
1147936260 17:44012951-44012973 TGGGAGTGAACTGTGAGTCTAGG - Intronic
1148489480 17:48013985-48014007 TGGGAAAGGCCTGAGATTTTTGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150575276 17:66425277-66425299 AGGGAGAGGTCTGTGGATGTTGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151048373 17:70948102-70948124 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1152573247 17:81129562-81129584 TGGGGGAGGAATGTGCTTCTAGG - Intronic
1152776332 17:82204275-82204297 TGGGAGAGTGCTGAGATGGTCGG - Intronic
1152925735 17:83086971-83086993 TGGGAGAGGCATGGGATGGTAGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153965954 18:10182229-10182251 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1155111276 18:22716946-22716968 TGGGAGAGGAAGATGATTTTTGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155701304 18:28747340-28747362 TGGGAGAGTTTTGTGATTGCCGG - Intergenic
1157316402 18:46593576-46593598 TAGGAGAGGATTGTGATGGATGG - Intronic
1157593178 18:48848324-48848346 TTGCAGAGGGCTGTGATTGGCGG - Intronic
1157762835 18:50276782-50276804 TGGGTGAGGGTTGTGATTGGGGG - Intronic
1157802365 18:50631013-50631035 TGTGAAAGGACTGTGAGTGCTGG - Intronic
1159383304 18:67690695-67690717 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1159890477 18:73948586-73948608 AGGGAGAGGTCTGGGCTTGTTGG + Intergenic
1159906532 18:74097464-74097486 TGGGTGAGGCCTGTGACTATTGG + Intronic
1160697815 19:493193-493215 TGGGGGAGGAATGAGATTGATGG - Intronic
1163467374 19:17476127-17476149 GGGGAGAGGGCTGTTATTGAGGG - Intronic
1164623529 19:29712080-29712102 AGGGAGAGGACTGTGCTTACTGG - Intronic
1166899603 19:46049476-46049498 TGGGTGAGGTCTGTGATTGCTGG + Intronic
925479161 2:4251096-4251118 TGGGTGAGGACTGTGACTGATGG - Intergenic
925555727 2:5129952-5129974 TGGGAGAGCCCTGTGATTCTAGG - Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927176839 2:20415795-20415817 GGGGTGAGGTCTGTGATTGCTGG - Intergenic
927314522 2:21666587-21666609 TGGGACAGGGCTGAGATTATTGG - Intergenic
927392491 2:22611019-22611041 TGGGATAGTACTGTTAGTGTTGG + Intergenic
927442113 2:23126376-23126398 GGGAAGAGGACTGTGAGTGTGGG - Intergenic
928342661 2:30458629-30458651 TGGGAGTGGAGAGTGATGGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929020820 2:37550961-37550983 TGAGAAAGGAATGTGAGTGTTGG + Intergenic
929486771 2:42361578-42361600 GGGGAGAGGGCGGTGATTGGTGG + Exonic
929531228 2:42754324-42754346 AGTGAGAGAACTGTGTTTGTGGG + Exonic
929805988 2:45145395-45145417 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
932270353 2:70403651-70403673 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
933897115 2:86821783-86821805 TTGGAGAGGACGGGGTTTGTGGG - Intronic
933914906 2:86980375-86980397 TGTTAGAGGACTGTGAAAGTTGG + Intronic
934008088 2:87789525-87789547 TGTTAGAGGACTGTGAAAGTTGG - Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935007101 2:99089613-99089635 TGGGTGAGGCCTGTAATTGCTGG + Intronic
935599626 2:104909657-104909679 TGGGAGTTGACTGTGGCTGTGGG - Intergenic
935771727 2:106430459-106430481 TGTTAGAGGACTGTGAAAGTTGG - Intronic
935908346 2:107865482-107865504 TGTTAGAGGACTGTGAAAGTTGG + Intronic
936130130 2:109830608-109830630 TGTTAGAGGACTGTGAAAGTTGG + Intronic
936214567 2:110540877-110540899 TGTTAGAGGACTGTGAAAGTTGG - Intronic
936423703 2:112395440-112395462 TGTTAGAGGACTGTGAAAGTTGG - Intronic
937767643 2:125680279-125680301 TGAGTGAGGCCTGTGATTGCCGG - Intergenic
938409344 2:131051039-131051061 TGGGAGAGGAATTTGAGTTTAGG - Exonic
938598278 2:132811536-132811558 TGGGTGAGGCCTGTGACTGCCGG - Intronic
939529022 2:143334197-143334219 TTAGAGAGATCTGTGATTGTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941402224 2:165044988-165045010 TGGGTGAGGCCTGTCATTGCTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943129660 2:183839882-183839904 TGGGTGAGGCCTGTGACTGCAGG + Intergenic
943621169 2:190150004-190150026 TGGGTGAGGCCTGTGACTGCCGG - Intronic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943909306 2:193542589-193542611 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
944432102 2:199644819-199644841 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
944528899 2:200648875-200648897 TGGGTGAGGCCTGTGACTGCTGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944707103 2:202301468-202301490 TGGGAGAGGACTGGGCGTGGTGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946036435 2:216746151-216746173 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
946464154 2:219896587-219896609 TGGGAGAAGACTCTCATGGTTGG + Intergenic
946508175 2:220324102-220324124 TGGGAGAGTGATGTGATTGATGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169336220 20:4759609-4759631 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170561882 20:17565698-17565720 GAGGAGAGGACTGGGATTATGGG + Intronic
1171242386 20:23582158-23582180 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1173267282 20:41495997-41496019 TGCAAGAGGACTGTCATGGTGGG - Intronic
1173409531 20:42797546-42797568 TGGCCGAGGACTGTGTTTGCGGG - Intronic
1175485970 20:59346558-59346580 GAGGAGAGGGCTGTGCTTGTGGG - Intergenic
1175946860 20:62562934-62562956 TGGGAGAAGACGGTGGCTGTCGG + Intronic
1176386926 21:6142774-6142796 TGGGCGAGCACTGTGATGGAGGG + Intergenic
1176957422 21:15122045-15122067 TTGGAGAGCTTTGTGATTGTGGG + Intergenic
1177174460 21:17689319-17689341 TGGGTGAGGTCTGTGACTGCCGG - Intergenic
1177847392 21:26306333-26306355 TGGGTGAGGCCTGTGACTGATGG + Intergenic
1178479415 21:32966789-32966811 TGGAAGATGACTGTGATTCTGGG - Intergenic
1178732843 21:35120613-35120635 AGGGTGAGGCCTGTGATTGCTGG + Intronic
1178801657 21:35801272-35801294 TGGGTGAGGCCTGTGACTGCCGG + Intronic
1179084222 21:38203268-38203290 TGGGTGAGGCCTGTGACTGTTGG - Intronic
1179736547 21:43395478-43395500 TGGGCGAGCACTGTGATGGAGGG - Intergenic
1181794149 22:25291651-25291673 TTGGGGATGACTGTGTTTGTGGG + Intergenic
1181937443 22:26449005-26449027 TGGGAGAGGAGTGTGTGTGTCGG + Intronic
1182931692 22:34180505-34180527 TGGGAGAGGACTGTGGGTTAGGG + Intergenic
1184385426 22:44171588-44171610 GGGGAGAGGACGGTTACTGTGGG + Intronic
1185408922 22:50672740-50672762 TGGGAGGGGCCTGTGATGCTGGG + Intergenic
950180180 3:10906515-10906537 TGGGAGAGGACTCTCTTTGGGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951761170 3:26148645-26148667 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
951865889 3:27306858-27306880 TGTTAGAGGAATGTGATGGTTGG - Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953190402 3:40681179-40681201 TGTCAGAGGACTGTCATTCTGGG + Intergenic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
954796375 3:53163257-53163279 TGGGGAGTGACTGTGATTGTGGG + Intronic
955175655 3:56611356-56611378 TGGGTGAGGCCTGTGACTGCTGG - Intronic
956995710 3:74824631-74824653 TGGGTGAGGTCTGTGACTGCTGG - Intergenic
957427885 3:80063819-80063841 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958263000 3:91404257-91404279 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961102634 3:124214594-124214616 TGGGAGAGGATTATGAGTGCTGG + Intronic
962008661 3:131372316-131372338 GGTGAGAGGACTGGGACTGTGGG - Intergenic
962984008 3:140518085-140518107 TGGGTGAGGACTGTAAGTGCTGG - Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964188974 3:153980282-153980304 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964643802 3:158936837-158936859 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
965216904 3:165874995-165875017 TGGGTGAGGCCTGTGATTGCCGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965547255 3:169928717-169928739 TGGGACAGGTCTCTGATTGGTGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966540821 3:181088045-181088067 TGGGGGAGAACTGTGATTTCAGG + Intergenic
967231685 3:187343554-187343576 TGGGAGAGGGCTGTGATTACAGG + Intergenic
967257534 3:187609120-187609142 TGGGAGAGGGCTGTGACTACTGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969136439 4:5033099-5033121 TGGTTGGGGACTGTGTTTGTGGG - Intergenic
970477549 4:16438896-16438918 TGGGAGAGATCTGTGGTTCTTGG + Intergenic
970658649 4:18260325-18260347 TGGGTGAGGCCTGTGATTGCCGG - Intergenic
970920768 4:21391781-21391803 AGGGAAAGGAATGTGATTGCAGG - Intronic
971576370 4:28280353-28280375 TGGGTGAGGACTGTGTCTGCTGG + Intergenic
971901017 4:32658292-32658314 TGGGTGAGGTCTGTGATGGCTGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973787067 4:54342057-54342079 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974474466 4:62361683-62361705 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975680179 4:76868232-76868254 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
976686360 4:87819546-87819568 TGGGTGAGGCCTGTGACTGCAGG - Intergenic
976963136 4:91003510-91003532 TGGGTGAGGCCTGTGACTGCTGG - Intronic
977489236 4:97691381-97691403 TGGGTGAGGCCTGTGGCTGTTGG + Intronic
978560363 4:110027485-110027507 CTGGATAGGACTGTAATTGTAGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978670683 4:111244321-111244343 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
979748270 4:124244046-124244068 TGGTGGAGGTCTGTGATTGAAGG - Intergenic
980087205 4:128403691-128403713 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
980195094 4:129578246-129578268 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
980990177 4:139732730-139732752 TGGGAGAGGCCTGAGCTAGTAGG - Intronic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981400992 4:144313689-144313711 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
981461083 4:145014292-145014314 TGGGTAAGGCCTGTGATTGCTGG + Intronic
982160848 4:152568047-152568069 AGGGAGAGGGCTGTGTATGTGGG - Intergenic
982218785 4:153107190-153107212 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
982491726 4:156038599-156038621 TGGGCGAGGCCTGTGACTGCTGG + Intergenic
982890953 4:160849316-160849338 TGGGAGAGGAGTGTCTTTCTGGG + Intergenic
983109114 4:163726072-163726094 TGGGACAGGATTTTGATAGTGGG - Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983449768 4:167895333-167895355 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
983461584 4:168030377-168030399 AGGAAGAGGACTGTGTTTGCTGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984323549 4:178224270-178224292 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
984475003 4:180224828-180224850 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
984838107 4:184040889-184040911 TGGGACAGGAGAGTGATTGATGG - Intergenic
986020413 5:3796379-3796401 TGGAAGAGGACTGTGGGTGCAGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986245408 5:6002460-6002482 TGGGAGAGGTCTGAGGTTGATGG - Intergenic
986986978 5:13511507-13511529 AGAGAGACGACTGTGAATGTAGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
989178982 5:38557097-38557119 TGGGAGAGGGGGATGATTGTTGG + Intronic
991063499 5:62402458-62402480 TGGGAAAGGACTGTACGTGTTGG + Intronic
991244878 5:64499794-64499816 TGGAAGAGGAATGTGACTGCTGG - Intergenic
991923857 5:71684279-71684301 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
991946655 5:71904368-71904390 TGGAATAGGACTCTGGTTGTTGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993048966 5:82903037-82903059 TGGGAGAGGACGATGATAATAGG + Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993917030 5:93756079-93756101 TGGGCGAGGCCTGTGACTGCCGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994051323 5:95365763-95365785 TGGGTGAGGGCTGTGACTGCTGG - Intergenic
994875285 5:105413852-105413874 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995357190 5:111252247-111252269 TGAGTGGGGACTCTGATTGTTGG + Intronic
995473030 5:112523409-112523431 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
995722485 5:115151233-115151255 TGGGTGAGGCCTGTGACTGCCGG + Intronic
996124164 5:119706226-119706248 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
996325398 5:122267410-122267432 TGGGCGAGGCCTGTGACTGGTGG + Intergenic
997669125 5:135656051-135656073 TGGGAGAGGAGTGTGACTATAGG + Intergenic
997715098 5:136036649-136036671 GGGGAGAGGACTGTGCTGGCTGG + Intronic
998050329 5:139027091-139027113 TGAGAGAAGACTGTGAGTCTTGG - Intronic
999491028 5:152052061-152052083 TGGGTGAGGCCTGTCACTGTCGG - Intergenic
999818488 5:155200880-155200902 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1002646502 5:180659152-180659174 TGGGCGAGGACTGCGATAGAGGG - Intergenic
1003581928 6:7347773-7347795 TGGGTGAGGCCTGTGACTGCAGG + Intronic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007397348 6:41585364-41585386 TGGGACAGGGCTGGGGTTGTGGG + Intronic
1008775424 6:55032110-55032132 TGGGTGAGAACTGTGACTGCTGG - Intergenic
1008992407 6:57618630-57618652 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1009013225 6:57867845-57867867 TGAGAGAGGAGTGTTAGTGTTGG + Intergenic
1009181031 6:60517743-60517765 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1009453153 6:63825106-63825128 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1009552572 6:65118035-65118057 TGGGGAAGGATTGTGGTTGTTGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1010008979 6:71028332-71028354 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010165128 6:72906184-72906206 TGGGTGAGGACTGTGACAGCAGG - Intronic
1011093539 6:83633664-83633686 TGAGTGAGGCCTGTGACTGTCGG - Intronic
1011233304 6:85187829-85187851 TGGGTGAGGCCTGTGACTGTCGG + Intergenic
1011789753 6:90885567-90885589 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1011833715 6:91404397-91404419 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1012155936 6:95819829-95819851 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1012793727 6:103734255-103734277 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1013901024 6:115156313-115156335 TGGGTGAGGCCTGTGATTGCTGG - Intergenic
1014531411 6:122563749-122563771 TGGGTGAGGCCTGTGACTGCTGG - Intronic
1014603880 6:123448439-123448461 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1015362387 6:132354941-132354963 TGAGTGAGGCCTGTGACTGTTGG - Intronic
1015480797 6:133706312-133706334 TGGATTAAGACTGTGATTGTGGG + Intergenic
1015849812 6:137560251-137560273 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017717635 6:157223496-157223518 TGGCAGTGGACTGTGACTGCTGG + Intergenic
1020566169 7:9798487-9798509 ATGAATAGGACTGTGATTGTTGG - Intergenic
1020639672 7:10739562-10739584 TGTGAGAGGAATGTGATAGTTGG - Intergenic
1020915223 7:14184481-14184503 TGTGTGAGGCCTGTGACTGTGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1021940485 7:25674092-25674114 AGGGAGAGGACTGTCAATCTCGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023315776 7:38934854-38934876 ATGGACAGGACTGTGATTGAAGG - Intergenic
1024545460 7:50513678-50513700 TGGGTGAGGGCTGTGACTGCTGG + Intronic
1025820602 7:64959351-64959373 TGGGTGAGGACTGTAACTGCTGG + Intergenic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027417664 7:77990339-77990361 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027963877 7:84981131-84981153 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1028197727 7:87926769-87926791 AGGGTGAGGTCTGTGATTGCTGG + Intergenic
1028739121 7:94251530-94251552 AGGGAGAGGACTGTATTTGCAGG + Intergenic
1028993587 7:97076079-97076101 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1029675503 7:102065674-102065696 GGGGAGAGGACTGAGAGTCTTGG + Intronic
1030325190 7:108211587-108211609 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1030603935 7:111619180-111619202 AGGCAGAGGACTGAGATTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031740091 7:125418671-125418693 TGGGTGAGGCCTGTGATTGCCGG + Intergenic
1032922667 7:136567118-136567140 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1032990578 7:137390517-137390539 TGGGAGATGTCTGTGCTTGGAGG - Exonic
1033023467 7:137750562-137750584 TGAGAGAGGAAGGTGAGTGTGGG - Intronic
1033449126 7:141447390-141447412 TGGGAGAGGACTGAGCCTGTTGG + Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034096681 7:148415315-148415337 TGGGAGAGGGCTGTGTCTGACGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034252272 7:149701860-149701882 TGGGAGAGGCCTGGGAGTGGGGG + Intergenic
1034261072 7:149755983-149756005 TGGGAGAGGACAGTGCTGGGTGG - Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034683217 7:152947111-152947133 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1037960552 8:23094695-23094717 TGGATGAGGAGTGTGATTGATGG + Intronic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038552639 8:28483093-28483115 TGGGAGAGGAAGGTGACAGTGGG + Intronic
1038908734 8:31937722-31937744 GGGGTGAGGCCTGTGATTGCTGG + Intronic
1039268481 8:35854601-35854623 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1039560135 8:38505917-38505939 TGGGACAGGGATGTGTTTGTGGG + Intergenic
1039683505 8:39769401-39769423 CAGGAGAGGAGTGTGACTGTGGG - Exonic
1041878006 8:62712524-62712546 TGGGTGAGGCCTGTGATTGCTGG - Intronic
1042467151 8:69140944-69140966 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047305178 8:123646911-123646933 GGGGAGCGGATTGTCATTGTGGG - Exonic
1047607364 8:126488511-126488533 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1047839753 8:128738394-128738416 TGGGAGTGGATTTTGACTGTGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048842211 8:138576240-138576262 TGGGAGGGCAGTGTGATTGAAGG + Intergenic
1050364191 9:4858985-4859007 TGTGTGTGGACTGTGATTCTGGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051570641 9:18554809-18554831 TGGGACAGGACATTGATAGTGGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052731481 9:32291347-32291369 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055392495 9:75838033-75838055 TGGAAGAGGACTGAGTTTGAAGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056322751 9:85452181-85452203 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1056828782 9:89897060-89897082 TTGGAGAGGACTGAGCTTGCAGG + Intergenic
1057119520 9:92558919-92558941 TGGGTGAGGCCTGTGACTGCCGG - Intronic
1057601110 9:96458107-96458129 TGGGAGATGCCTGTAATTATAGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059733136 9:117076124-117076146 TGAGAGAGAGCTGTGATTGGGGG + Intronic
1059793827 9:117668946-117668968 TGGGAGAGGAAGGTAACTGTGGG + Intergenic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060866141 9:126999266-126999288 TGGGGGAGGACGCTGATAGTGGG - Intronic
1060879359 9:127107287-127107309 TGGGGGAGGAATGGGATTGCTGG - Intronic
1061502608 9:131012659-131012681 AAGGAGAGGCCTGGGATTGTCGG + Intronic
1061808161 9:133147973-133147995 TGGGACAAGACTGTCCTTGTTGG - Intronic
1061852416 9:133423909-133423931 TGGGAGAGGACAGTGAGGGCTGG + Intronic
1186236953 X:7522677-7522699 TGGGCTAGGAGTATGATTGTTGG - Intergenic
1187006226 X:15235171-15235193 TGGAAGAGGACTGTACCTGTTGG + Intergenic
1187219216 X:17307859-17307881 TGGGTGAGACCTGTGATTGCCGG - Intergenic
1187483236 X:19677475-19677497 TGGGAGAGAACTGTAAATGTAGG - Intronic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189218143 X:39344909-39344931 TGGGTGAGGCCTGTGACTGCCGG + Intergenic
1189603159 X:42648684-42648706 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189666630 X:43362095-43362117 TGAGAGAGGACAGAGAATGTTGG - Intergenic
1191909314 X:66131064-66131086 AGGGTGAGGCCTGTGACTGTCGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192820197 X:74637004-74637026 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1192968198 X:76202465-76202487 TGGGTGAGGTCTGTGACTGCTGG - Intergenic
1192995150 X:76505552-76505574 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1193156835 X:78183203-78183225 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1193290069 X:79762336-79762358 TGGATGAGGCCTGTCATTGTTGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1194468027 X:94256584-94256606 TGGCAGCGCTCTGTGATTGTGGG - Intergenic
1194701512 X:97119831-97119853 TGGGTGAGGCCTGTGACTGCCGG - Intronic
1195019497 X:100812547-100812569 TGGGTGAGGCCTGTGACTGCCGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195363498 X:104106800-104106822 GGGGATAGGAATGGGATTGTGGG - Intronic
1195363508 X:104106840-104106862 GGGGATAGGAATGAGATTGTGGG - Intronic
1195365040 X:104116932-104116954 GGGGATAGGAATGTAATTGTAGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195598090 X:106715899-106715921 GGGCAGTGGACTGTCATTGTAGG - Intronic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195795434 X:108642091-108642113 TGGGTGAGGCCTGTGACTGCTGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196590511 X:117481635-117481657 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1197066256 X:122237389-122237411 TGGGTGAGGCCTGTGACTGCTGG - Intergenic
1197363555 X:125536353-125536375 TGGGTGAGGCCTGTGACTGCAGG + Intergenic
1197518893 X:127473028-127473050 TGGGTGAGACCTGTGACTGTTGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197671672 X:129284513-129284535 TGGGTGAGGTCTGTGACTGCTGG - Intergenic
1198485418 X:137082438-137082460 TGGGAGATGCCTGTGCCTGTTGG + Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198843224 X:140880910-140880932 TGGGTGAGGCCTGTGACTGCTGG + Intergenic
1199057878 X:143319203-143319225 TGGGTGAGGGCTGTGACTGTAGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1199985271 X:152945663-152945685 TGGGAGGGGACTGTGATAGGAGG + Intronic