ID: 1038102506

View in Genome Browser
Species Human (GRCh38)
Location 8:24394208-24394230
Sequence TGTTAACTAAGATCTCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038102504_1038102506 30 Left 1038102504 8:24394155-24394177 CCGAATACTTTGTGGGTCTCTTT 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1038102506 8:24394208-24394230 TGTTAACTAAGATCTCCAAAGGG 0: 1
1: 0
2: 0
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038102506 Original CRISPR TGTTAACTAAGATCTCCAAA GGG Intronic
901719312 1:11183248-11183270 AGTTCACAAAGATATCCAAAAGG - Intronic
907139223 1:52170006-52170028 TCTTAAGTAAAATCTGCAAAAGG - Intronic
907235826 1:53046452-53046474 TATAAAAGAAGATCTCCAAATGG - Intronic
911489880 1:98551224-98551246 TATTACCTATGAACTCCAAAAGG + Intergenic
911698469 1:100922940-100922962 TGATAACTAAGATCTGCTAGAGG + Intronic
911788861 1:101985288-101985310 TGTTAACTTACATGACCAAACGG - Intronic
915624085 1:157104133-157104155 TATTAACTAAAATCTTCAAAAGG - Intergenic
916282669 1:163069474-163069496 TGTTAAATAAGATGTGCAAAGGG + Exonic
917196825 1:172475547-172475569 TGTTTACTAGGATCTCTAATTGG - Intergenic
917341096 1:173978503-173978525 TGTTTGCTAACAGCTCCAAATGG + Exonic
921172628 1:212562763-212562785 TGTTATCTAAGATCAACATATGG + Intergenic
923930908 1:238695547-238695569 TGTTAAACAAAATCTCCAGATGG - Intergenic
924080449 1:240391469-240391491 TGTCTCCTAAGTTCTCCAAATGG + Intronic
1063026814 10:2187219-2187241 TGTTCTCTAATATATCCAAAAGG + Intergenic
1064951958 10:20862453-20862475 AATGAACTAAGATCACCAAATGG + Intronic
1067308281 10:45087682-45087704 TTTTAACTAATACCCCCAAAAGG + Intergenic
1071214236 10:83380309-83380331 TGGTAAGTGAGATATCCAAAAGG + Intergenic
1073778166 10:106808880-106808902 TGAGAACAAAGATCTCTAAATGG - Intronic
1074127518 10:110541044-110541066 TGTTAACACAGATGGCCAAAGGG - Intergenic
1074645509 10:115447064-115447086 TATTAACAAAGTTTTCCAAAAGG + Intronic
1074972941 10:118556547-118556569 TGTTAACTAAGAGTTCCAGAAGG - Intergenic
1078521479 11:12067295-12067317 TGCTTACTAAGATCTGCAGAGGG - Intergenic
1081187272 11:40059168-40059190 TTTTGACTAAATTCTCCAAAGGG + Intergenic
1081280587 11:41205019-41205041 TTTTACCTGGGATCTCCAAAGGG - Intronic
1082064901 11:47892138-47892160 TGGTACATAAGATCTCTAAAAGG - Intergenic
1082726428 11:56742533-56742555 TGTTCCCCAAGATCTCCCAAAGG + Intergenic
1086101582 11:83105648-83105670 TGTAAAAGAAGATATCCAAATGG - Intergenic
1087261214 11:96014317-96014339 TGGTAACTAGGCTCTCCACAGGG + Intronic
1089491252 11:118885616-118885638 TGGTTACTAAGATGTCCAACTGG - Intronic
1090793511 11:130113472-130113494 TGGTTACTAAGTTGTCCAAATGG - Intronic
1092118990 12:6030635-6030657 TTTTAAACAAGATCTCCTAAGGG + Intronic
1094189479 12:27682942-27682964 TTTAAACTAAGCTCTCCAGAAGG + Intronic
1094672864 12:32587852-32587874 GCTTAATTAATATCTCCAAATGG - Intronic
1095738217 12:45581246-45581268 TGTTCACTTGGATCTCTAAAGGG + Intergenic
1097064449 12:56310583-56310605 TGGTCACAAAGATCTGCAAATGG + Exonic
1097349328 12:58531020-58531042 TGTTTACTGATATCTCCACAGGG - Intergenic
1097520070 12:60656258-60656280 TGTGAACTCAGGTCTCCAATGGG + Intergenic
1098411484 12:70188975-70188997 TGATGACTCAGAACTCCAAAGGG - Intergenic
1098597265 12:72288967-72288989 TGATAAATAAGAGCTCCCAACGG - Intronic
1099317292 12:81100321-81100343 TGTAAAATAAGAAGTCCAAAAGG + Intronic
1101842100 12:108335072-108335094 TGTTAACTAAGATTGACTAATGG + Intronic
1105359648 13:19696124-19696146 TGTTCACAAAAATCTCAAAATGG + Intronic
1106338039 13:28802384-28802406 TTTTACCTATGATCTCAAAAAGG - Intergenic
1109744703 13:66609009-66609031 TATTAAGTGAGATCTTCAAATGG + Intronic
1111293303 13:86196255-86196277 TGTTCACTAAAATCACCACAAGG - Intergenic
1111764400 13:92509622-92509644 TGTTAACTTTGATCTCTGAAGGG - Intronic
1112315244 13:98355644-98355666 TGTTAATGATGATCTCCTAATGG + Intronic
1113089208 13:106599258-106599280 TGTAAAATAGGATCTCCTAAGGG + Intergenic
1114802430 14:25792632-25792654 TATTAACTTAGATTTCCAAAGGG - Intergenic
1118337971 14:64870674-64870696 TGGTATTTAACATCTCCAAAGGG - Intronic
1119371695 14:74151141-74151163 TTTTAACTAAAAACTTCAAAGGG - Intronic
1120746755 14:88159257-88159279 TGTAAACAAAGTTCACCAAAGGG - Intergenic
1127229141 15:56969702-56969724 TCTCCACTAATATCTCCAAATGG - Intronic
1127988940 15:64096655-64096677 TGTAAACTAAGATCCAGAAAGGG - Intronic
1133861467 16:9599287-9599309 TATTAACCAACATGTCCAAATGG + Intergenic
1134197653 16:12171243-12171265 TGATGACTAAGAGCGCCAAATGG + Intronic
1137548276 16:49418929-49418951 TGTGAACTAAGACCACCAACTGG + Intergenic
1138156604 16:54711258-54711280 TGTTAAATAATCTCTCAAAAAGG + Intergenic
1138543581 16:57703267-57703289 TGCTCATTAAGATCTCCATAAGG + Intronic
1140637567 16:76933916-76933938 TGTAAACTAAGTTCTCCTTATGG + Intergenic
1144316065 17:14062700-14062722 TGTTAACTAGGTAATCCAAAGGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147010337 17:37441256-37441278 TGTAAAATAAGATGTCAAAAAGG + Intronic
1151003036 17:70400436-70400458 TCTTAACTAAGAGCTCCTCAAGG - Intergenic
1151475307 17:74341765-74341787 TGTTAACTCTGATCGACAAAGGG + Intronic
1151611544 17:75179079-75179101 TGCTAAAGAAGTTCTCCAAAAGG + Intergenic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1159988477 18:74874119-74874141 TGTTACCTAAGAACTGCAGATGG + Intronic
1164214957 19:23136256-23136278 TGTAAAGTAAGATTACCAAAGGG - Intronic
1164397196 19:27876664-27876686 TGTTCTCTAAGCTGTCCAAAAGG - Intergenic
1164816573 19:31208801-31208823 TGGTAAGTAAGATCTGCACATGG - Intergenic
1167823037 19:51947392-51947414 TCTTATCCAAGATATCCAAAAGG - Intronic
1168091371 19:54087304-54087326 TATTAAGTAAGACCACCAAATGG + Intergenic
926173978 2:10572586-10572608 TGTAAACAAAGATCTCTAAAAGG - Intronic
929072100 2:38041578-38041600 TGATAAAGAAGATCTACAAAAGG - Intronic
930134893 2:47892287-47892309 TGTTAACTAATATCTTGAGATGG - Intronic
931158152 2:59658724-59658746 TGTTTACACAGATCTCCAATCGG + Intergenic
931487857 2:62711497-62711519 GCTTAACTAAGATCTCCATCTGG - Intronic
931656663 2:64515460-64515482 TGTTAACAATGATCTTGAAAAGG - Intergenic
935469878 2:103445516-103445538 TGATAACAAAGATATGCAAATGG + Intergenic
938127036 2:128681902-128681924 TGTAAATTATGTTCTCCAAAGGG - Intergenic
939790619 2:146569764-146569786 TGGTATCTAACATCTCCAACAGG - Intergenic
942831852 2:180246252-180246274 TGCTAACAAATATCTGCAAATGG - Intergenic
943120675 2:183731273-183731295 TATTTAATAAGATATCCAAATGG - Intergenic
943168506 2:184364546-184364568 TGTTATCCATGATCTCCAAGAGG + Intergenic
944719030 2:202404631-202404653 CCTTAACTATGAACTCCAAAAGG - Intronic
945663846 2:212717972-212717994 CCTTAAGTAAGATCTCCAGAAGG - Intergenic
947942655 2:234071857-234071879 TGTCAACGTAGACCTCCAAAGGG - Intronic
949075219 2:242052877-242052899 GGTTAACTAAGATCTGGAATTGG + Intergenic
1169482260 20:5994952-5994974 TGTTAAATAAATTCTCCAAAGGG + Exonic
1170030596 20:11939875-11939897 TGTCAACTTAGAGATCCAAACGG - Intergenic
1172627750 20:36357909-36357931 TGTTCCCTAAGCCCTCCAAAGGG - Intronic
1174990345 20:55502243-55502265 TTTCAACTTACATCTCCAAAGGG + Intergenic
1175385455 20:58592069-58592091 CGTGAACTAAGATGTCCACAAGG - Intergenic
1175586377 20:60143861-60143883 TGTGAACTCAGTTCTCCAATAGG + Intergenic
1177303554 21:19282901-19282923 TGTTCACGTAGATCTCTAAAAGG + Intergenic
1178069929 21:28953218-28953240 TGTTAAATAACAGCTGCAAAAGG + Exonic
949770514 3:7572199-7572221 ACTGAACTAAGATCTCCAAAAGG - Intronic
951152776 3:19311837-19311859 TGTTAACTCAGTTCTCAGAAAGG - Intronic
951941321 3:28081949-28081971 TTTTAAATAAGATCTTCCAAAGG + Intergenic
954118450 3:48480331-48480353 TGTTAAATAAGAACTCATAAAGG + Intronic
959037797 3:101386485-101386507 TGGTAACTAGGCTCTCAAAATGG - Intronic
959800871 3:110494543-110494565 AGTTAACTAGAATCTCCGAAAGG + Intergenic
959805141 3:110542192-110542214 TGGTAAATAAGAACTACAAAAGG - Intergenic
962674191 3:137741731-137741753 TGTTAGCTATTGTCTCCAAAAGG + Intergenic
964735851 3:159916030-159916052 TGTATACTGAGTTCTCCAAATGG - Intergenic
965746492 3:171931871-171931893 TGTCAACTAGTATCTCCAACTGG - Intronic
966458589 3:180147337-180147359 TGTTAACTAAGTTTTTTAAAAGG + Intergenic
970230867 4:13909482-13909504 AGTTAATTTATATCTCCAAAGGG - Intergenic
970581207 4:17475903-17475925 GGTTATCTAAGAACTGCAAATGG - Intronic
971463670 4:26930627-26930649 TGTTAACTAAGCTTTCCAACAGG - Intronic
971709363 4:30092152-30092174 TTTTAACTAAGATAGCCAAATGG + Intergenic
972694174 4:41428553-41428575 AGTTACTTAAGAACTCCAAATGG - Intronic
972934596 4:44117622-44117644 TGATAACTGAGAACTCCAAATGG + Intergenic
973998841 4:56489234-56489256 AGTTAACTATGTTCTCTAAAGGG + Intronic
974004476 4:56542478-56542500 TCTCAACTAAGATCTTAAAAAGG + Intronic
974116128 4:57581167-57581189 TCTTAATGTAGATCTCCAAAGGG - Intergenic
974192217 4:58520339-58520361 TGTATACTAAGATTTGCAAATGG - Intergenic
975227064 4:71885422-71885444 TATTCACTAGGAACTCCAAAAGG - Intergenic
977071684 4:92398013-92398035 TGTAAGGTAAGTTCTCCAAAAGG - Intronic
978168876 4:105644563-105644585 TGTTGACTAAGAATTCCACATGG + Intronic
978832042 4:113099014-113099036 TGATAAATAACATCTACAAAAGG + Intronic
979096750 4:116560417-116560439 TATTAACTGATTTCTCCAAAAGG + Intergenic
980345794 4:131616541-131616563 TGTCAAATAAGAAATCCAAAGGG - Intergenic
980940399 4:139268931-139268953 TAATAACAAAGATTTCCAAAAGG - Intronic
982488333 4:155996858-155996880 TGTTATCTAAAATCTCCTATGGG + Intergenic
984492139 4:180448133-180448155 TGTTTAGTAAGATTTTCAAAAGG - Intergenic
988130121 5:27093732-27093754 AGTCAACTAAGAGCTTCAAATGG - Intronic
988921551 5:35946999-35947021 TTTTAAAGAAGGTCTCCAAAAGG - Intergenic
991616694 5:68504349-68504371 TGGTAAATATGATCTGCAAAGGG - Intergenic
993433681 5:87864125-87864147 TGTTTATTAAGATCTCAAAAAGG - Intergenic
993659164 5:90609058-90609080 TGTTAACTAACATCTTGGAAAGG + Intronic
994741733 5:103627220-103627242 TGTCAACAAAGATTTCCACAAGG + Intergenic
996210978 5:120809493-120809515 TGTTATCAAATATCTCAAAATGG + Intergenic
999911571 5:156207113-156207135 TGAGATCTAAAATCTCCAAAGGG - Intronic
1001008649 5:168077208-168077230 TGTTCACTAAAATTTCCAAAAGG + Intronic
1002405814 5:179029920-179029942 TGGTAACTAAAATTTCCAAAAGG - Intronic
1002901228 6:1411131-1411153 TTTCATCAAAGATCTCCAAAGGG - Intergenic
1003164256 6:3662406-3662428 TGTTTCGTAAGATTTCCAAAAGG - Intergenic
1004145930 6:13066363-13066385 TGTTTACTAAGATCTGAAAGAGG + Intronic
1004835080 6:19521743-19521765 TGTTAACTAAGATGAGCATAAGG + Intergenic
1004872978 6:19926144-19926166 TGTCAACAAAGATCTCACAAAGG + Intergenic
1009560396 6:65233960-65233982 AGTTGACTGTGATCTCCAAAGGG + Intronic
1009761103 6:68007336-68007358 AGATAACTCAGATCTCTAAATGG - Intergenic
1009823544 6:68836968-68836990 TGTAAATTAAGATCCTCAAAAGG - Intronic
1010688664 6:78881731-78881753 TGGTAAATAAGTTTTCCAAAGGG + Intronic
1014494999 6:122110603-122110625 TGTCAGCTAAGATCTGAAAAAGG + Intergenic
1016122063 6:140356308-140356330 TGTTACCTATGTTCTTCAAAAGG - Intergenic
1017075273 6:150612059-150612081 TATTAACTAAGAACTAGAAAAGG - Intronic
1017184203 6:151584441-151584463 TGTTAATTAAGAATTTCAAACGG + Intronic
1017913142 6:158812374-158812396 TTTTAAATAAGCTCTCCAGATGG - Intronic
1018887019 6:167947998-167948020 AGATAACTGAGATGTCCAAAGGG - Intronic
1019059328 6:169244011-169244033 TGTTGGCAAAGATCTCCAAATGG + Intronic
1021914332 7:25416365-25416387 TGTTTCCTAATTTCTCCAAATGG - Intergenic
1022076953 7:26981233-26981255 TGTTTAGTAAGATATCCCAAAGG - Intronic
1023163524 7:37321268-37321290 TGTTAACTAAAAAGTCCATAAGG - Intronic
1027543212 7:79493974-79493996 TGTTAACGAAGCACTCAAAAAGG - Intergenic
1030013870 7:105198925-105198947 CGTTATCTTAGATCTCCAAGAGG - Intronic
1031057852 7:117013266-117013288 TGATAATTAAGATGTGCAAATGG - Intronic
1031500347 7:122506828-122506850 TGTTAACTGTGTTGTCCAAATGG + Intronic
1031953105 7:127912320-127912342 AGTGGACTAAGATCTACAAAAGG - Intronic
1032475674 7:132210022-132210044 TCTTAAAGAAGGTCTCCAAATGG + Intronic
1036984553 8:13513264-13513286 ATTTAATTAAAATCTCCAAATGG - Intronic
1037583076 8:20257426-20257448 GGTTACCAAAGATCTCCACATGG - Intronic
1038102506 8:24394208-24394230 TGTTAACTAAGATCTCCAAAGGG + Intronic
1038819448 8:30938969-30938991 AGTTAACTGAGTTCTCCACATGG + Intergenic
1041417082 8:57622670-57622692 TGTAAACTTATATCTCCATATGG - Intergenic
1042718355 8:71800521-71800543 TGTTTCCTATGTTCTCCAAATGG - Intergenic
1043796294 8:84545922-84545944 TATTAACTGATAGCTCCAAAAGG + Intronic
1044285429 8:90406788-90406810 TATATACTAAGAACTCCAAAAGG + Intergenic
1046312681 8:112459103-112459125 TATTAACTAAAATGTCCAACGGG + Intronic
1046318888 8:112544790-112544812 TATCCACTAAGATGTCCAAAAGG - Intronic
1047198371 8:122742422-122742444 ACTGAAATAAGATCTCCAAAGGG - Intergenic
1047580973 8:126214808-126214830 TGTTGACAAAAATCTCCATATGG - Intergenic
1048698145 8:137051991-137052013 TGTTAACTCAGAACCCCAGAAGG - Intergenic
1048884432 8:138898331-138898353 TGTTTGCTAAGATAACCAAAGGG - Intronic
1051198550 9:14590782-14590804 TGAAAACTAGGATCTACAAAAGG + Intergenic
1054979784 9:71192127-71192149 TATTAAATAAGACATCCAAACGG + Intronic
1058183136 9:101822092-101822114 TGTGAACAACCATCTCCAAAAGG - Intergenic
1059737269 9:117114889-117114911 TGTTGGCTAAGAGCTCCAATGGG - Intronic
1060172622 9:121474301-121474323 GGTTAACTGAGTTCTACAAATGG - Intergenic
1061604779 9:131700465-131700487 TGTAAACTAAAAACTCCAGAGGG + Intronic
1185531817 X:826223-826245 GTCTAACCAAGATCTCCAAAAGG + Intergenic
1186444724 X:9617498-9617520 TGTTAATTAATATAACCAAATGG + Intronic
1186880748 X:13863684-13863706 TTTTAACCATGATCTCCTAATGG + Intronic
1187065169 X:15827813-15827835 AGTTAACTAAAAACTCCAAGAGG - Intronic
1188147412 X:26630597-26630619 TGTCAACTAAAATATCCATAGGG + Intergenic
1188736918 X:33728024-33728046 TGTCAACAAAGATTTCCAATAGG - Intergenic
1188947368 X:36322820-36322842 TATATAATAAGATCTCCAAAGGG + Intronic
1190141628 X:47851190-47851212 TGTTAACTAAGATTTGTATAAGG - Intronic
1192215932 X:69158128-69158150 TGTTAACTAGGAACCCCAAGTGG - Intergenic
1194013692 X:88592723-88592745 TGTTAACTAAAATCTCAAATTGG - Intergenic
1195560695 X:106279465-106279487 TGTTATACAAGATATCCAAAAGG + Intergenic
1195952204 X:110286774-110286796 TTTTAACTAAGGTCTCCAGATGG - Intronic
1196288159 X:113906618-113906640 AGTTAACAAAAAGCTCCAAAGGG + Intergenic
1197517049 X:127445676-127445698 TTTTAATTAAAATCTCCAGAAGG - Intergenic
1197946534 X:131845149-131845171 AGTTTAGTAAGCTCTCCAAAGGG - Intergenic
1199814371 X:151384904-151384926 CATTAGCTAAGATCGCCAAAGGG + Intergenic