ID: 1038113491

View in Genome Browser
Species Human (GRCh38)
Location 8:24526251-24526273
Sequence CAGTTGTCCTTAAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038113491_1038113496 8 Left 1038113491 8:24526251-24526273 CCTTTTTCCCTTAAGGACAACTG 0: 1
1: 0
2: 3
3: 30
4: 262
Right 1038113496 8:24526282-24526304 ACAAAATCTTTGGAGGAAAATGG No data
1038113491_1038113495 1 Left 1038113491 8:24526251-24526273 CCTTTTTCCCTTAAGGACAACTG 0: 1
1: 0
2: 3
3: 30
4: 262
Right 1038113495 8:24526275-24526297 AAGAAATACAAAATCTTTGGAGG No data
1038113491_1038113494 -2 Left 1038113491 8:24526251-24526273 CCTTTTTCCCTTAAGGACAACTG 0: 1
1: 0
2: 3
3: 30
4: 262
Right 1038113494 8:24526272-24526294 TGTAAGAAATACAAAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038113491 Original CRISPR CAGTTGTCCTTAAGGGAAAA AGG (reversed) Intronic
901101622 1:6723520-6723542 CAGGTGTCCTTATGAGAAAAAGG + Intergenic
903535564 1:24064140-24064162 CAGTTGTCCAAAAAGGACAAGGG - Exonic
905680440 1:39867097-39867119 CTCTTCTCTTTAAGGGAAAAGGG + Intronic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
906002589 1:42439602-42439624 CAGTTGCCCTGAAGAGTAAAGGG - Intronic
906806645 1:48785519-48785541 CAGTGGTTGCTAAGGGAAAATGG - Intronic
906828000 1:49002678-49002700 CAGTCTTCCTTAAGAGCAAAAGG + Intronic
906943840 1:50278706-50278728 CAATTGTCCTTAAGGAACAGGGG - Intergenic
907513613 1:54980074-54980096 CAGTTCTCCTTGAGGGAGGAAGG + Intergenic
908550796 1:65206874-65206896 CATTTTCCCTTATGGGAAAAGGG + Intronic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
909431326 1:75590630-75590652 CCGTGGGCCTTAAGGGAACATGG + Intronic
909877409 1:80825510-80825532 CAGTTGTCCATAATGTAATAAGG + Intergenic
910041189 1:82853214-82853236 TAGTTGTCCTTAATGGTAGAAGG + Intergenic
910118362 1:83757430-83757452 CAGTTGCCCCTATGGGAAATCGG - Intergenic
910502236 1:87905928-87905950 CCCTTTTCCTTAAGGGCAAATGG + Intergenic
910520126 1:88111425-88111447 CAGTTGTTCTGATGAGAAAAGGG - Intergenic
910664339 1:89708187-89708209 GAGTTGTCCTTGAAAGAAAATGG + Intronic
910862465 1:91755454-91755476 CAGGCTTCCTTTAGGGAAAACGG - Intronic
911223656 1:95279038-95279060 CAGTTCTCATAAGGGGAAAATGG + Intergenic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
912780313 1:112540610-112540632 TGGTTGACCTTCAGGGAAAAAGG + Intronic
913273214 1:117114255-117114277 AAGTTATCCTTAAAGGAAAGGGG - Intronic
915683642 1:157607761-157607783 CAGTTATCCTTTAGGAATAAAGG + Intergenic
915946968 1:160160115-160160137 CAGGCCTCCTTAAGGGGAAAGGG - Intronic
916419899 1:164627199-164627221 CATTTTTCCTTAAGGAAAAAAGG - Intronic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
917312313 1:173690459-173690481 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
920223022 1:204418084-204418106 CAGAATTCCTTAAGTGAAAATGG - Intergenic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922541589 1:226424333-226424355 CTGTTGTCCTTTTAGGAAAAGGG + Intergenic
924648335 1:245901013-245901035 AAGTTCTTCTTAAGGCAAAATGG + Intronic
1063790207 10:9436176-9436198 CATTTGTCCTTACAGAAAAATGG + Intergenic
1064331697 10:14400395-14400417 GAATTGTCATTGAGGGAAAAGGG - Intronic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1067781944 10:49214089-49214111 CAGGGGGCCTAAAGGGAAAATGG - Intergenic
1069091806 10:64208343-64208365 CTGGTGTCCTTAAAAGAAAAGGG - Intergenic
1069105706 10:64381000-64381022 CAGTGTTCCATAAGGGAACATGG - Intergenic
1071229468 10:83568461-83568483 AAGATTTCCTTAAGGGAAAGAGG - Intergenic
1071283615 10:84124873-84124895 AATTTGTTTTTAAGGGAAAAAGG + Intergenic
1072513641 10:96154051-96154073 CAGTTCTCCTTCAGGGACTAGGG - Intronic
1073067659 10:100772951-100772973 CAGTTGTCCTCACTAGAAAATGG - Intronic
1073546323 10:104352661-104352683 CAGAGGTCCTTAAGGGACCACGG + Intergenic
1074578696 10:114695567-114695589 CAGTTTTCCTTATCTGAAAAGGG - Intergenic
1075195805 10:120358116-120358138 CAGGTTTCTTTAAGTGAAAATGG + Intergenic
1076403824 10:130199877-130199899 CAGTTGCCCTTAATGCAGAATGG + Intergenic
1080460095 11:32447073-32447095 CAGTTGCCTTTAAGGAAATAGGG - Intergenic
1080546031 11:33319579-33319601 CAGTTGTCCCCAATGCAAAATGG + Intronic
1081175805 11:39924951-39924973 AAGATGTCCTGAAGGTAAAAAGG + Intergenic
1083243312 11:61405882-61405904 CAGTTTTCCCTTAGAGAAAATGG - Intronic
1083375257 11:62215232-62215254 TAATTGTCTTTCAGGGAAAAAGG - Intergenic
1084641399 11:70428731-70428753 CAGATGTCTTTAAGGGAAATTGG + Intronic
1085825678 11:79844632-79844654 CAGTTGTCTTAAAGTGAACATGG + Intergenic
1086432682 11:86750481-86750503 CAGATGTCCTTAATGGAATGGGG + Intergenic
1087014162 11:93540183-93540205 CAGTTGTCCTCAGGGGGAAAAGG - Intronic
1090005536 11:122999048-122999070 AATTTGTTCTTAAGGGATAAGGG - Intergenic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1090469140 11:126963925-126963947 CACTTGTCCATAACGGAAGAGGG + Intronic
1090613441 11:128492791-128492813 CAGTTTTACTTTAGAGAAAAGGG + Intronic
1090727726 11:129542806-129542828 CAGATGCCCTTACAGGAAAAAGG + Intergenic
1093840937 12:23899996-23900018 CAGTTGACTTTCAAGGAAAAAGG + Intronic
1099103996 12:78478246-78478268 CCCTTGTTTTTAAGGGAAAAAGG - Intergenic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1099822210 12:87726690-87726712 AACATGTCTTTAAGGGAAAAAGG + Intergenic
1100385807 12:94103696-94103718 CAGTTTTCCCAAAGGTAAAATGG + Intergenic
1100737762 12:97556401-97556423 CTGTTCTCCTTCAGGGAACACGG - Intergenic
1101684086 12:106999818-106999840 CAGTTGCCCATAAAGGGAAAGGG + Exonic
1106298691 13:28441942-28441964 TAGTTTTCCTTAAGCAAAAATGG - Intronic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1108143102 13:47447180-47447202 CAGTTATCCTTTAGGGATAATGG + Intergenic
1109241048 13:59888723-59888745 AAGTTGTCCTTCAGGCAAAAGGG - Intronic
1109265065 13:60188544-60188566 CAGTTGCCCTTTAGAGTAAATGG - Intergenic
1111870817 13:93830075-93830097 CAGTTGTACTTAAGGTAAGTGGG + Intronic
1113201322 13:107868802-107868824 CAGCGCTCCTTAAAGGAAAATGG - Intergenic
1116677357 14:47922810-47922832 CAAATGTCTTTAGGGGAAAAAGG + Intergenic
1118160937 14:63289549-63289571 CAGATGTCCTTAATAGTAAAAGG + Intronic
1119121633 14:72084591-72084613 GAGTTCTCCTGAAGGGAGAAAGG - Intronic
1120861175 14:89256150-89256172 CAGGTGTCCTTGAGGGGACAGGG - Intronic
1121551089 14:94801224-94801246 CAGTTGTTCCTAAGGGAACTGGG + Intergenic
1121745239 14:96284103-96284125 CAAGTTTCCTTAAGGGCAAATGG + Exonic
1121793272 14:96714852-96714874 CAGTTGACCCTTAGAGAAAACGG + Intergenic
1122317107 14:100832489-100832511 CTGTGTTCATTAAGGGAAAAGGG - Intergenic
1124646078 15:31438215-31438237 AGGTTGGCCTTAGGGGAAAAGGG + Intergenic
1126382493 15:48063680-48063702 CAGATGTCCTTATAAGAAAAAGG + Intergenic
1127202292 15:56668267-56668289 CAGATGTACATAAGGCAAAAAGG + Intronic
1127688332 15:61370219-61370241 CAGGTGTCAGGAAGGGAAAATGG - Intergenic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1129868636 15:78927123-78927145 CAGTTGACCTCAAGTGAATAGGG - Intronic
1131328530 15:91472562-91472584 CAAATGTCCTTCAGAGAAAAGGG - Intergenic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1133174085 16:4000721-4000743 CAGTGGTCCTTTAGGGCTAAGGG - Intronic
1133561881 16:6957898-6957920 CAGATGTCCTGCATGGAAAAGGG - Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1138128643 16:54459506-54459528 CAGTTGTCATGAAAGGAAACTGG + Intergenic
1140032886 16:71352569-71352591 TAGATGTCCCTAAGGGAAATAGG + Intergenic
1140118791 16:72065763-72065785 TAGTTGTCTTTAAGGGAAAGAGG - Intronic
1141716899 16:85732061-85732083 CAGTTGTCCTTAAAAGAGAAGGG + Intronic
1143160323 17:4865512-4865534 CATTTGTCCTTATGAGAAAAAGG - Intronic
1145216631 17:21057415-21057437 CAGGTGGCCTTCAGGGAAATGGG + Intergenic
1146496417 17:33326624-33326646 TGGTTTTCCTCAAGGGAAAAGGG - Intronic
1147555381 17:41475759-41475781 CAGATGTCCTTAAGGGACAAGGG + Intergenic
1148481763 17:47964380-47964402 CAGGTGTCATTCTGGGAAAAAGG - Intergenic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1153173837 18:2347768-2347790 CACTGGTGCTTAAGGGAAAAAGG - Intergenic
1153826742 18:8882070-8882092 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
1154215653 18:12414271-12414293 CAGATGTCCCTAAGAGAAACTGG + Intronic
1154975618 18:21454741-21454763 CCCTTGACCTTGAGGGAAAAAGG - Intronic
1156148556 18:34216351-34216373 TAGTTGTCCTTCAAGGATAAAGG + Intronic
1156967774 18:43116098-43116120 CAGTTTTCATTCCGGGAAAATGG + Intergenic
1157063800 18:44323509-44323531 CAGTTAAACTTAGGGGAAAATGG + Intergenic
1157142665 18:45126345-45126367 CAGTTTTGCTGAAGGGACAATGG + Intergenic
1157881321 18:51323617-51323639 CAATTGTCTTTAAGGAAAATGGG - Intergenic
1160596647 18:79980067-79980089 CTGGTGTCCTTAGAGGAAAATGG + Intronic
1161109731 19:2462447-2462469 CAGTTTTCCATAATGGAAATGGG - Intergenic
1161373777 19:3928481-3928503 CAGGTGCCCTTTAGGGGAAAAGG + Intergenic
1161895980 19:7080650-7080672 TTGTTGTCCTCAAGGCAAAATGG + Intronic
1162268536 19:9595622-9595644 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1165037104 19:33041597-33041619 CTGTTGTCGTTAAGAGAACAAGG + Intronic
1166576399 19:43842867-43842889 AAGATGTTCTTAAGTGAAAATGG - Intronic
1167051376 19:47080971-47080993 CAGTTGTACTTAGGGCAACATGG - Intronic
1167241023 19:48343082-48343104 CAGTTTTCCTTATTGGAAAATGG + Intronic
1167535580 19:50049136-50049158 CACTTGTCACTAAAGGAAAAAGG - Intronic
1168275448 19:55275427-55275449 CAAATGTCCTTAAAGGATAAAGG + Intronic
925837514 2:7960260-7960282 CAGTTTACCTGAAGGGAGAATGG - Intergenic
926891064 2:17639125-17639147 CAGTTGCCCTTCAGGGGAGAGGG + Intronic
928246864 2:29638083-29638105 AAGGTGTGCTTTAGGGAAAACGG - Intronic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
929961376 2:46498763-46498785 CCTTTGTCCTTATGTGAAAAAGG + Intronic
931161903 2:59702171-59702193 CCTTGGTCCTTAAGGGAATATGG - Intergenic
932005804 2:67925948-67925970 CAGTTATCCTTTAGAGAGAATGG - Intergenic
932280377 2:70486251-70486273 CAGTGGCCCTTAAGGGACGAAGG + Intronic
932881589 2:75507131-75507153 CAGTTATCCATAAGGTAAGAGGG - Intronic
933390143 2:81657235-81657257 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
933608753 2:84412190-84412212 CAGTTGCCCCTAAAGGAAAATGG + Intergenic
936888486 2:117341213-117341235 CTGTTATCCTTATGAGAAAAGGG - Intergenic
938215946 2:129515263-129515285 CAGTTACCCTTAAGGCAAACTGG - Intergenic
938936284 2:136130477-136130499 CAGTCGTTCTTAAGGAAAATAGG + Intergenic
940352158 2:152702645-152702667 TAGTTGTCTCAAAGGGAAAAAGG - Intronic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
941317398 2:164010175-164010197 CAGTTGTCAGTAAAAGAAAAGGG - Intergenic
941859759 2:170266877-170266899 CAGTTTTCCAGAAGGGAAACTGG + Intronic
943110153 2:183594671-183594693 CAGTTCTCCTTGGGGGATAAGGG - Intergenic
943837688 2:192534401-192534423 CATTAGTCCTTAAGGAAAAGCGG + Intergenic
944507898 2:200432447-200432469 CATTTATCCTCAAGGCAAAAAGG + Intronic
945154101 2:206819637-206819659 TAATTGTACTTAAGGGAAACAGG - Intergenic
946589473 2:221228375-221228397 CAAGTGTTCTTAAAGGAAAAGGG - Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947378252 2:229519718-229519740 CAGATGCCCTTAAGGGTGAAGGG - Intronic
948156875 2:235790586-235790608 AAGTTGTCCTTAAGGCAATGGGG - Intronic
1173405054 20:42757259-42757281 GAGTTCTGCTTAAGGGAAAAAGG - Intronic
1174851549 20:54000164-54000186 CAGATGTCCTTAGGGGGAAGAGG - Intronic
1177128623 21:17228831-17228853 CATCTGTCCTAAATGGAAAATGG + Intergenic
1178107833 21:29340047-29340069 CAGTTGTTTTTATAGGAAAATGG + Intronic
1179199840 21:39206416-39206438 CAGATGTCATTAAGGGAAGGGGG - Intronic
1179213409 21:39346813-39346835 CAGTTTTCCCAAAAGGAAAAAGG - Intronic
1179277850 21:39908323-39908345 CAGGTGTCATTAAGGGGACAAGG + Intronic
1180648558 22:17359936-17359958 CTGTTGGCCTTAAAGGAAAAAGG + Intronic
1181878369 22:25957807-25957829 CAGTTGTCCTTATAAGAAAAAGG - Intronic
1182342170 22:29632237-29632259 CAGTCGTCCTTACAGGAAATGGG - Intronic
1183796257 22:40120931-40120953 CAGGTGTCCCCAAGGGAAAAGGG + Intronic
1184065151 22:42114385-42114407 TAGTTGTCTTTAAGGGAAAGAGG + Intergenic
1184905264 22:47479584-47479606 CTGTTGACCTTATGGGAAAAAGG - Intronic
949106259 3:203604-203626 CCCTTGTCCTGAAGGGATAATGG + Intronic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
950846801 3:16022889-16022911 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
950981459 3:17311209-17311231 AAGTTATCTTTAAGGGGAAAAGG - Intronic
951928051 3:27931613-27931635 GAGCTTTCTTTAAGGGAAAACGG + Intergenic
952011034 3:28901689-28901711 TAGCTGACCTTGAGGGAAAATGG - Intergenic
952766076 3:36955463-36955485 CAGTTTGCCTCAGGGGAAAATGG - Intergenic
954659238 3:52218044-52218066 AAGGTGTCCTAAAGGGAAAAGGG + Intergenic
954713212 3:52514974-52514996 CATTTCTCCTAGAGGGAAAAAGG - Exonic
956387124 3:68731371-68731393 CAGTGGTCCATTTGGGAAAATGG - Intergenic
956609217 3:71105222-71105244 CACTTGTGCTTCAGGGAAAGAGG - Intronic
956896792 3:73668997-73669019 CAGGTGTTCTTAAAGGAAAATGG - Intergenic
960170060 3:114450111-114450133 CAGTTTTCCAGAAGGGAAAAAGG - Intronic
960232108 3:115240576-115240598 CAGTTGACTTTAAGGGAAAATGG + Intergenic
960678212 3:120218269-120218291 TAGTTCACCTTAAGGGAGAAGGG - Intronic
963773549 3:149415287-149415309 AAGTTGTTTTTAAGGGAAATTGG - Intergenic
964818828 3:160747531-160747553 TAGTTGTTCTTAAAAGAAAAAGG + Intergenic
965984793 3:174737429-174737451 CATTTGTTGTTAAGGTAAAATGG + Intronic
967145965 3:186606361-186606383 CAGATGTTTTTCAGGGAAAATGG - Intergenic
968511954 4:999742-999764 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968511975 4:999828-999850 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968511996 4:999914-999936 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968593190 4:1469881-1469903 CAGATGTACTCAAGGTAAAATGG - Intergenic
969574506 4:8029150-8029172 CAGCTGTCCTCACGGGAGAATGG - Intronic
970275438 4:14394768-14394790 CAATTATCCTCAATGGAAAAAGG - Intergenic
971096775 4:23415070-23415092 TAGTTGACCTTAAGAAAAAAAGG - Intergenic
972411695 4:38801736-38801758 TAGCTGTTGTTAAGGGAAAAAGG - Intronic
973079415 4:45971207-45971229 TACTTTTCCTTAAAGGAAAAAGG - Intergenic
973975978 4:56262935-56262957 CAGCTGGCCCTAAGGGAAGAGGG + Intronic
977800893 4:101229838-101229860 CAGTTGTTTTTAAGGCAAATAGG + Intronic
978122506 4:105097519-105097541 CAGAAGTCCTTAAGAGAAAAGGG + Intergenic
978313828 4:107414552-107414574 TATTTGTTTTTAAGGGAAAAAGG - Intergenic
979611365 4:122692228-122692250 CTGATGTCCTTATGAGAAAATGG + Intergenic
980459029 4:133081168-133081190 CATTTCTCCTGAAGGTAAAATGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
983466906 4:168105585-168105607 CATTTGTCTTTATGGTAAAATGG + Intronic
984001438 4:174251516-174251538 AAGTTGTCCTAAAAGGCAAAGGG + Intronic
986614565 5:9602984-9603006 CAGTTGACTTTAGGGGAGAATGG - Intergenic
986876890 5:12122271-12122293 CAGTTGTCCTAAAGGGCATGAGG - Intergenic
987895073 5:23934066-23934088 CTGATGTCCTTATAGGAAAAAGG + Intergenic
988373942 5:30408698-30408720 CATTTGCCGTTCAGGGAAAATGG + Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
988693742 5:33598104-33598126 CAGATGTCATCAAGGGCAAAAGG + Intronic
988752697 5:34206757-34206779 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
989236205 5:39151226-39151248 CATATTTCCTAAAGGGAAAACGG - Intronic
990066202 5:51717552-51717574 TAGTTCTACTTAAGGGAACAGGG + Intergenic
991740467 5:69667571-69667593 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
991757032 5:69885596-69885618 GAGTTGTTCTGAGGGGAAAATGG - Intergenic
991792042 5:70247312-70247334 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
991819928 5:70543676-70543698 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
991836435 5:70761478-70761500 GAGTTGTTCTGAGGGGAAAATGG - Intergenic
991884489 5:71247638-71247660 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
996319910 5:122203922-122203944 CAGTTGTCATTAAATGGAAATGG - Intergenic
997588395 5:135058084-135058106 CCGGTGTCCTTATGAGAAAAGGG - Intronic
997857448 5:137384789-137384811 TAGTTGTCCTTAAAAGAGAAAGG - Intronic
998365545 5:141628446-141628468 CAGTTGTCCTTAAGGATGAATGG - Intronic
999884260 5:155903255-155903277 CAGTTGTCAATAAAGGAAAAAGG - Intronic
1001427969 5:171636804-171636826 CAGGTGTCCTTATAAGAAAAAGG + Intergenic
1001951951 5:175822536-175822558 AAGATGGCCTGAAGGGAAAAGGG + Intronic
1002427167 5:179183221-179183243 CAGTTTTTCTTAAGAGAGAAGGG + Intronic
1003166050 6:3679514-3679536 CAGTGGTGCCTAAGAGAAAATGG + Intergenic
1003390425 6:5708471-5708493 CAGGTGTCCTGAAGGGAATCAGG + Intronic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005550862 6:26913477-26913499 GAGTTGTTCTGAGGGGAAAATGG + Intergenic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1009619842 6:66061576-66061598 TAGTAGTCCTTAAGTGATAAAGG - Intergenic
1010574624 6:77515565-77515587 CAGTTGTCATTAACTGAAATGGG - Intergenic
1011160439 6:84383275-84383297 CCGTTTTCCATAATGGAAAATGG + Intergenic
1011399678 6:86946628-86946650 CAGTTGTCCTCAAAGGACCATGG - Intronic
1012572843 6:100752059-100752081 CAGCTGTTCTTAAGGGTAAGAGG - Intronic
1012696729 6:102393265-102393287 CAGCTGTCATTAAGGGAATTGGG - Intergenic
1014265549 6:119273025-119273047 CAGATGTCAGAAAGGGAAAAAGG + Intronic
1015011192 6:128350420-128350442 CAAATGCCCTTAAAGGAAAAAGG + Intronic
1016755698 6:147683504-147683526 CAGTTATTCTTAAGTGAAACTGG + Intronic
1019139982 6:169936962-169936984 CTGGTGTCCTTAGGGGAAGAGGG - Intergenic
1020744821 7:12068066-12068088 TAGTTGTCTTTAAGGGGAAAAGG - Intergenic
1021299037 7:18948499-18948521 CAGTTATCGTTAAGGGAAACTGG + Intronic
1022778983 7:33558970-33558992 CAATTGTACTTAGGGGAAGAAGG - Intronic
1023798746 7:43814855-43814877 TATTTGTTTTTAAGGGAAAAAGG - Intergenic
1024535011 7:50423194-50423216 CTGGTGTCCTTATAGGAAAAGGG + Intergenic
1028018700 7:85744848-85744870 TAATTGTCTTTAAGGGAAAAAGG + Intergenic
1030167396 7:106569125-106569147 CATCTGTCCTTAAGTGATAAGGG + Intergenic
1033751859 7:144366255-144366277 CAGGGGTCCAGAAGGGAAAATGG - Intronic
1035766531 8:2110599-2110621 CACTGGGCATTAAGGGAAAAAGG - Intronic
1036044960 8:5129577-5129599 GAGTAGTCCTTTAGAGAAAATGG + Intergenic
1036452825 8:8883395-8883417 CAGGTGTCCTTAATCAAAAAGGG + Intronic
1036697083 8:10982551-10982573 CTGTTGTGACTAAGGGAAAACGG + Intronic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038578143 8:28722931-28722953 CAGTAGTCTATTAGGGAAAAGGG + Intronic
1038652506 8:29418443-29418465 GATTTGTCCTGAAGGGAAAGAGG + Intergenic
1038890048 8:31711322-31711344 AAGTTGTCCTTTAGGAATAAAGG - Intronic
1039971267 8:42323548-42323570 CAGTTTCCCTTAAGAGCAAAGGG + Intronic
1041656680 8:60358817-60358839 AAATTGTTCTTCAGGGAAAATGG - Intergenic
1043864242 8:85357639-85357661 CAGACTTCCTAAAGGGAAAAGGG + Intronic
1045577849 8:103445220-103445242 TTGTGGTCCTTCAGGGAAAAGGG - Intergenic
1049491777 8:142907944-142907966 CAGGTGTCCTTGGAGGAAAAGGG - Intronic
1051259635 9:15250433-15250455 CATTTTTCCTTAAGACAAAAGGG - Intronic
1052935368 9:34088589-34088611 CTGGTCTCCTTAAGGGAACAGGG + Intronic
1053163278 9:35828414-35828436 CAGATGTCTTTGAGGGAAGAGGG + Intronic
1055809280 9:80133485-80133507 CATTTGTGGTTAAGGGATAATGG + Intergenic
1056414909 9:86366658-86366680 TATTTGTTTTTAAGGGAAAAAGG + Intergenic
1056600436 9:88042734-88042756 TAGTTGTATTTAAGGGAAAGAGG + Intergenic
1056663105 9:88559113-88559135 CAGTCGTCCCTATGGGAAAGAGG - Intronic
1060115965 9:120940977-120940999 CAGGTGTCCTTATGAGAAGAGGG - Intergenic
1060468305 9:123927573-123927595 CAGTTTCCCTGAAGGTAAAATGG - Intronic
1062658494 9:137616012-137616034 CAGTTCTCCTTTAGGGCGAAGGG + Exonic
1186997989 X:15144075-15144097 CAGATGTCCTTAAGAAAACAAGG - Intergenic
1188846617 X:35079585-35079607 CAGTTCTCTCTACGGGAAAAAGG + Intergenic
1189367443 X:40399797-40399819 CAAGTGTCCTTAAAGGGAAAGGG - Intergenic
1189834371 X:45005404-45005426 TATTTGTTTTTAAGGGAAAAAGG + Intronic
1190915201 X:54806916-54806938 CAGTTGTGATGAAGGAAAAATGG + Intergenic
1191865474 X:65700248-65700270 CAGTTTTCCTACAGGTAAAATGG - Intronic
1192492157 X:71585417-71585439 CAGTTGTCCTGAGAGGTAAATGG + Intronic
1192689086 X:73341828-73341850 CACTTGTCCTTCAAGGAGAAAGG - Intergenic
1194205858 X:91010333-91010355 CAGTTGTTAGTAGGGGAAAATGG - Intergenic
1195238666 X:102928403-102928425 CAGTTGTCTTTAAGGTACAATGG - Intergenic
1195740089 X:108056075-108056097 CTGTTGTCCTTATAAGAAAACGG - Intronic
1196755653 X:119155241-119155263 GAGTTGTCCTTAAGGGAGCTAGG + Intergenic
1197173257 X:123457523-123457545 CAGTGTTCCTCAAAGGAAAATGG - Intronic
1197583744 X:128317179-128317201 TGGTTGTCCTTTAGGGGAAAAGG - Intergenic
1197674919 X:129318944-129318966 CAGTTTTCTTTGAGGGAATATGG - Intergenic
1197702097 X:129607148-129607170 CAGTTTTCTTTAAGGGAGAGGGG + Intergenic
1198151766 X:133917679-133917701 CATTTGTCCTAGAGAGAAAAAGG + Intronic
1198834714 X:140792362-140792384 AAGTAGTAATTAAGGGAAAAGGG - Intergenic
1199544882 X:148997656-148997678 TATTTGTCCTTACTGGAAAATGG + Exonic
1199637397 X:149826532-149826554 TATTTGTTTTTAAGGGAAAAAGG - Intergenic
1200551614 Y:4585144-4585166 CAGTTGTTAGTAGGGGAAAATGG - Intergenic
1200763614 Y:7062246-7062268 TACTTGTTATTAAGGGAAAAAGG + Intronic
1200949762 Y:8884904-8884926 CAGTTTTCATTACTGGAAAAAGG - Intergenic