ID: 1038113820

View in Genome Browser
Species Human (GRCh38)
Location 8:24530181-24530203
Sequence AAAGCCAAGGTGCTACAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038113816_1038113820 12 Left 1038113816 8:24530146-24530168 CCGAAACTCAATATTTGGGAATG No data
Right 1038113820 8:24530181-24530203 AAAGCCAAGGTGCTACAAGGTGG No data
1038113815_1038113820 13 Left 1038113815 8:24530145-24530167 CCCGAAACTCAATATTTGGGAAT No data
Right 1038113820 8:24530181-24530203 AAAGCCAAGGTGCTACAAGGTGG No data
1038113812_1038113820 27 Left 1038113812 8:24530131-24530153 CCAGTCTTGCAGCTCCCGAAACT No data
Right 1038113820 8:24530181-24530203 AAAGCCAAGGTGCTACAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038113820 Original CRISPR AAAGCCAAGGTGCTACAAGG TGG Intergenic
No off target data available for this crispr