ID: 1038119949

View in Genome Browser
Species Human (GRCh38)
Location 8:24601979-24602001
Sequence CCCTCCTAGAAAATCACTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038119945_1038119949 23 Left 1038119945 8:24601933-24601955 CCAAGTGTGGAAAGACTGTTGGC No data
Right 1038119949 8:24601979-24602001 CCCTCCTAGAAAATCACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038119949 Original CRISPR CCCTCCTAGAAAATCACTAA GGG Intergenic
No off target data available for this crispr