ID: 1038122102

View in Genome Browser
Species Human (GRCh38)
Location 8:24628892-24628914
Sequence CACTTGATTCAGGTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038122102_1038122110 21 Left 1038122102 8:24628892-24628914 CCAGGGGAGACCTGAATCAAGTG No data
Right 1038122110 8:24628936-24628958 AGAGATTTGGGATTTGAGATAGG No data
1038122102_1038122106 -10 Left 1038122102 8:24628892-24628914 CCAGGGGAGACCTGAATCAAGTG No data
Right 1038122106 8:24628905-24628927 GAATCAAGTGATTTGGGACCTGG No data
1038122102_1038122108 8 Left 1038122102 8:24628892-24628914 CCAGGGGAGACCTGAATCAAGTG No data
Right 1038122108 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data
1038122102_1038122109 9 Left 1038122102 8:24628892-24628914 CCAGGGGAGACCTGAATCAAGTG No data
Right 1038122109 8:24628924-24628946 CTGGAAGAACAGAGAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038122102 Original CRISPR CACTTGATTCAGGTCTCCCC TGG (reversed) Intergenic
No off target data available for this crispr