ID: 1038122105

View in Genome Browser
Species Human (GRCh38)
Location 8:24628902-24628924
Sequence GGTCCCAAATCACTTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038122105_1038122111 21 Left 1038122105 8:24628902-24628924 CCTGAATCAAGTGATTTGGGACC No data
Right 1038122111 8:24628946-24628968 GATTTGAGATAGGTTTGAATTGG No data
1038122105_1038122108 -2 Left 1038122105 8:24628902-24628924 CCTGAATCAAGTGATTTGGGACC No data
Right 1038122108 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data
1038122105_1038122110 11 Left 1038122105 8:24628902-24628924 CCTGAATCAAGTGATTTGGGACC No data
Right 1038122110 8:24628936-24628958 AGAGATTTGGGATTTGAGATAGG No data
1038122105_1038122109 -1 Left 1038122105 8:24628902-24628924 CCTGAATCAAGTGATTTGGGACC No data
Right 1038122109 8:24628924-24628946 CTGGAAGAACAGAGAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038122105 Original CRISPR GGTCCCAAATCACTTGATTC AGG (reversed) Intergenic