ID: 1038122107

View in Genome Browser
Species Human (GRCh38)
Location 8:24628923-24628945
Sequence CCAAATCTCTCTGTTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038122107_1038122112 25 Left 1038122107 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data
Right 1038122112 8:24628971-24628993 CAGTTTATTTCATCATTCAATGG No data
1038122107_1038122111 0 Left 1038122107 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data
Right 1038122111 8:24628946-24628968 GATTTGAGATAGGTTTGAATTGG No data
1038122107_1038122110 -10 Left 1038122107 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data
Right 1038122110 8:24628936-24628958 AGAGATTTGGGATTTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038122107 Original CRISPR CCAAATCTCTCTGTTCTTCC AGG (reversed) Intergenic