ID: 1038122108

View in Genome Browser
Species Human (GRCh38)
Location 8:24628923-24628945
Sequence CCTGGAAGAACAGAGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038122102_1038122108 8 Left 1038122102 8:24628892-24628914 CCAGGGGAGACCTGAATCAAGTG No data
Right 1038122108 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data
1038122105_1038122108 -2 Left 1038122105 8:24628902-24628924 CCTGAATCAAGTGATTTGGGACC No data
Right 1038122108 8:24628923-24628945 CCTGGAAGAACAGAGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038122108 Original CRISPR CCTGGAAGAACAGAGAGATT TGG Intergenic