ID: 1038122316

View in Genome Browser
Species Human (GRCh38)
Location 8:24631287-24631309
Sequence CAGACCTAGGACTGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038122316_1038122320 -1 Left 1038122316 8:24631287-24631309 CCTCCTCCACAGTCCTAGGTCTG No data
Right 1038122320 8:24631309-24631331 GTGTCTGTGTTATGTTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038122316 Original CRISPR CAGACCTAGGACTGTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr