ID: 1038123310

View in Genome Browser
Species Human (GRCh38)
Location 8:24642517-24642539
Sequence CTGACTCTTCTCTGCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038123310_1038123317 9 Left 1038123310 8:24642517-24642539 CCCACCATGCAGAGAAGAGTCAG No data
Right 1038123317 8:24642549-24642571 AGAAGTTGTCCGAGGGCCACAGG No data
1038123310_1038123321 30 Left 1038123310 8:24642517-24642539 CCCACCATGCAGAGAAGAGTCAG No data
Right 1038123321 8:24642570-24642592 GGCTCAGAGGCAGCATATTATGG No data
1038123310_1038123318 17 Left 1038123310 8:24642517-24642539 CCCACCATGCAGAGAAGAGTCAG No data
Right 1038123318 8:24642557-24642579 TCCGAGGGCCACAGGCTCAGAGG No data
1038123310_1038123315 1 Left 1038123310 8:24642517-24642539 CCCACCATGCAGAGAAGAGTCAG No data
Right 1038123315 8:24642541-24642563 GAGAATGAAGAAGTTGTCCGAGG No data
1038123310_1038123316 2 Left 1038123310 8:24642517-24642539 CCCACCATGCAGAGAAGAGTCAG No data
Right 1038123316 8:24642542-24642564 AGAATGAAGAAGTTGTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038123310 Original CRISPR CTGACTCTTCTCTGCATGGT GGG (reversed) Intergenic
No off target data available for this crispr