ID: 1038129217

View in Genome Browser
Species Human (GRCh38)
Location 8:24710663-24710685
Sequence ATGGAGGAACAGAGTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038129213_1038129217 -10 Left 1038129213 8:24710650-24710672 CCTAGTACCTAGCATGGAGGAAC No data
Right 1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038129217 Original CRISPR ATGGAGGAACAGAGTAAGGA GGG Intergenic
No off target data available for this crispr