ID: 1038130948

View in Genome Browser
Species Human (GRCh38)
Location 8:24730976-24730998
Sequence GAGTTTTATTTTTAACTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038130947_1038130948 10 Left 1038130947 8:24730943-24730965 CCAGGGTCAGAAGATTTTTGGAA No data
Right 1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG No data
1038130945_1038130948 22 Left 1038130945 8:24730931-24730953 CCATGGAATTGGCCAGGGTCAGA No data
Right 1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038130948 Original CRISPR GAGTTTTATTTTTAACTACT AGG Intergenic
No off target data available for this crispr