ID: 1038131258

View in Genome Browser
Species Human (GRCh38)
Location 8:24733999-24734021
Sequence GAACTAAGGAGAACATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038131255_1038131258 15 Left 1038131255 8:24733961-24733983 CCACTGAACAACAGCACACAAAA No data
Right 1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG No data
1038131254_1038131258 18 Left 1038131254 8:24733958-24733980 CCACCACTGAACAACAGCACACA No data
Right 1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038131258 Original CRISPR GAACTAAGGAGAACATCAGC AGG Intergenic
No off target data available for this crispr