ID: 1038134944

View in Genome Browser
Species Human (GRCh38)
Location 8:24775228-24775250
Sequence CAGAGTCATCCCTATGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038134944_1038134945 19 Left 1038134944 8:24775228-24775250 CCTACTTCATAGGGATGACTCTG No data
Right 1038134945 8:24775270-24775292 CATGTAAAATGTTTAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038134944 Original CRISPR CAGAGTCATCCCTATGAAGT AGG (reversed) Intergenic
No off target data available for this crispr