ID: 1038142595

View in Genome Browser
Species Human (GRCh38)
Location 8:24862987-24863009
Sequence CAGGACAAGGACATGTGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038142595_1038142598 2 Left 1038142595 8:24862987-24863009 CCGGAGCACATGTCCTTGTCCTG No data
Right 1038142598 8:24863012-24863034 TTTTACCAATAGTTTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038142595 Original CRISPR CAGGACAAGGACATGTGCTC CGG (reversed) Intergenic
No off target data available for this crispr