ID: 1038145636

View in Genome Browser
Species Human (GRCh38)
Location 8:24892847-24892869
Sequence GTCTGGTAGGTGAATCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038145630_1038145636 14 Left 1038145630 8:24892810-24892832 CCAGGGGAGAGAGCCTTGTTCAG No data
Right 1038145636 8:24892847-24892869 GTCTGGTAGGTGAATCTGGTGGG No data
1038145629_1038145636 15 Left 1038145629 8:24892809-24892831 CCCAGGGGAGAGAGCCTTGTTCA No data
Right 1038145636 8:24892847-24892869 GTCTGGTAGGTGAATCTGGTGGG No data
1038145631_1038145636 1 Left 1038145631 8:24892823-24892845 CCTTGTTCAGAATATTCTTTGAA No data
Right 1038145636 8:24892847-24892869 GTCTGGTAGGTGAATCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038145636 Original CRISPR GTCTGGTAGGTGAATCTGGT GGG Intergenic
No off target data available for this crispr