ID: 1038149336

View in Genome Browser
Species Human (GRCh38)
Location 8:24928312-24928334
Sequence GTCCATGGGCAGCCACGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038149336_1038149341 6 Left 1038149336 8:24928312-24928334 CCCACTCGTGGCTGCCCATGGAC No data
Right 1038149341 8:24928341-24928363 GCATGCACTTCCCCTCTCTGAGG 0: 2
1: 1
2: 9
3: 30
4: 217
1038149336_1038149345 23 Left 1038149336 8:24928312-24928334 CCCACTCGTGGCTGCCCATGGAC No data
Right 1038149345 8:24928358-24928380 CTGAGGCCTGTAAAAGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038149336 Original CRISPR GTCCATGGGCAGCCACGAGT GGG (reversed) Intergenic
No off target data available for this crispr