ID: 1038151516

View in Genome Browser
Species Human (GRCh38)
Location 8:24945054-24945076
Sequence ATTGACAAACCCATTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038151510_1038151516 -3 Left 1038151510 8:24945034-24945056 CCTGCTGACCATAGGGGCCAATT No data
Right 1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG No data
1038151506_1038151516 16 Left 1038151506 8:24945015-24945037 CCTGGGTTCACACTGGGATCCTG No data
Right 1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG No data
1038151502_1038151516 29 Left 1038151502 8:24945002-24945024 CCATAACCAGAGTCCTGGGTTCA No data
Right 1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG No data
1038151503_1038151516 23 Left 1038151503 8:24945008-24945030 CCAGAGTCCTGGGTTCACACTGG No data
Right 1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG No data
1038151501_1038151516 30 Left 1038151501 8:24945001-24945023 CCCATAACCAGAGTCCTGGGTTC No data
Right 1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038151516 Original CRISPR ATTGACAAACCCATTGGGGA AGG Intergenic
No off target data available for this crispr