ID: 1038157859

View in Genome Browser
Species Human (GRCh38)
Location 8:25007764-25007786
Sequence CTTCCAACACAGAGGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038157859_1038157862 -7 Left 1038157859 8:25007764-25007786 CCAAGTTCCCTCTGTGTTGGAAG No data
Right 1038157862 8:25007780-25007802 TTGGAAGTCTCTGTTTAGAGTGG No data
1038157859_1038157865 0 Left 1038157859 8:25007764-25007786 CCAAGTTCCCTCTGTGTTGGAAG No data
Right 1038157865 8:25007787-25007809 TCTCTGTTTAGAGTGGGAGGAGG No data
1038157859_1038157864 -3 Left 1038157859 8:25007764-25007786 CCAAGTTCCCTCTGTGTTGGAAG No data
Right 1038157864 8:25007784-25007806 AAGTCTCTGTTTAGAGTGGGAGG No data
1038157859_1038157863 -6 Left 1038157859 8:25007764-25007786 CCAAGTTCCCTCTGTGTTGGAAG No data
Right 1038157863 8:25007781-25007803 TGGAAGTCTCTGTTTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038157859 Original CRISPR CTTCCAACACAGAGGGAACT TGG (reversed) Intergenic
No off target data available for this crispr