ID: 1038162958

View in Genome Browser
Species Human (GRCh38)
Location 8:25057620-25057642
Sequence CTCCATTTAAAAATGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038162958_1038162963 20 Left 1038162958 8:25057620-25057642 CCTTGGCCCATTTTTAAATGGAG No data
Right 1038162963 8:25057663-25057685 AATTTGTGTAAGTTCCTTATAGG No data
1038162958_1038162964 26 Left 1038162958 8:25057620-25057642 CCTTGGCCCATTTTTAAATGGAG No data
Right 1038162964 8:25057669-25057691 TGTAAGTTCCTTATAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038162958 Original CRISPR CTCCATTTAAAAATGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr