ID: 1038164177

View in Genome Browser
Species Human (GRCh38)
Location 8:25068768-25068790
Sequence ACCATCTGTAGAATTACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038164174_1038164177 12 Left 1038164174 8:25068733-25068755 CCAATGCTCTCTGAGCTCATAGG No data
Right 1038164177 8:25068768-25068790 ACCATCTGTAGAATTACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038164177 Original CRISPR ACCATCTGTAGAATTACCTA AGG Intergenic
No off target data available for this crispr