ID: 1038164229

View in Genome Browser
Species Human (GRCh38)
Location 8:25069268-25069290
Sequence TGGAGGGTCAGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038164229_1038164238 22 Left 1038164229 8:25069268-25069290 CCTTCCTCCCTCCTGACCCTCCA No data
Right 1038164238 8:25069313-25069335 GAGATCAGCTGTGCAACGCAAGG No data
1038164229_1038164241 28 Left 1038164229 8:25069268-25069290 CCTTCCTCCCTCCTGACCCTCCA No data
Right 1038164241 8:25069319-25069341 AGCTGTGCAACGCAAGGGGTTGG No data
1038164229_1038164240 24 Left 1038164229 8:25069268-25069290 CCTTCCTCCCTCCTGACCCTCCA No data
Right 1038164240 8:25069315-25069337 GATCAGCTGTGCAACGCAAGGGG No data
1038164229_1038164239 23 Left 1038164229 8:25069268-25069290 CCTTCCTCCCTCCTGACCCTCCA No data
Right 1038164239 8:25069314-25069336 AGATCAGCTGTGCAACGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038164229 Original CRISPR TGGAGGGTCAGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr