ID: 1038170082

View in Genome Browser
Species Human (GRCh38)
Location 8:25123411-25123433
Sequence CCTTCTATCCTGTAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038170076_1038170082 21 Left 1038170076 8:25123367-25123389 CCACATAAATGATCTGAAATCTT No data
Right 1038170082 8:25123411-25123433 CCTTCTATCCTGTAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038170082 Original CRISPR CCTTCTATCCTGTAGCTGCA GGG Intergenic
No off target data available for this crispr