ID: 1038177768

View in Genome Browser
Species Human (GRCh38)
Location 8:25196832-25196854
Sequence TACAACTCATTCCAAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038177768_1038177770 2 Left 1038177768 8:25196832-25196854 CCAGTTCTTTGGAATGAGTTGTA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1038177770 8:25196857-25196879 GGAATTGAACCGTATGTCTGTGG No data
1038177768_1038177771 8 Left 1038177768 8:25196832-25196854 CCAGTTCTTTGGAATGAGTTGTA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1038177771 8:25196863-25196885 GAACCGTATGTCTGTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038177768 Original CRISPR TACAACTCATTCCAAAGAAC TGG (reversed) Intronic
901869614 1:12130264-12130286 TACAACCCATTGAACAGAACAGG - Intronic
903523706 1:23975827-23975849 TACAACTTCTTGCAAAGAAATGG + Intronic
904428173 1:30445073-30445095 TGCAACACATTCCAAAGATTAGG - Intergenic
905937524 1:41836695-41836717 CACAACTAACTCCAAAGGACTGG - Intronic
907938918 1:59068130-59068152 TATAAATCATTCCAAAGCCCTGG - Intergenic
910568626 1:88675523-88675545 TACAACTCTTCCTACAGAACAGG - Intergenic
910966684 1:92815134-92815156 TAACATTCATCCCAAAGAACAGG + Intergenic
912183872 1:107251091-107251113 TTCAAATCATTCCAAATCACTGG + Intronic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
912968766 1:114260630-114260652 CACAACTCAATCCAGAGAATTGG - Intergenic
913146535 1:115995710-115995732 TACAAATCATTGAAAAGAATAGG - Intronic
913184862 1:116361682-116361704 TATAATTCATGGCAAAGAACTGG + Intergenic
916277016 1:163005771-163005793 AACAACTCATTGTAAAGATCTGG - Intergenic
919276656 1:195426677-195426699 TACAACAAATTCCAGAGAATGGG - Intergenic
921815757 1:219561508-219561530 TACATTTCATACTAAAGAACTGG + Intergenic
921950203 1:220921728-220921750 AACAACTCAATCCACAGCACTGG - Intergenic
923813454 1:237346553-237346575 TACAACTCAATACAAGGAAAGGG - Intronic
924201630 1:241665819-241665841 TACAAATTAATCCAAAGAAGAGG + Intronic
1064134722 10:12740783-12740805 GACAACACATTCCATAGTACTGG + Intronic
1064853914 10:19742932-19742954 TACAAGTACTTTCAAAGAACAGG + Intronic
1068657771 10:59592541-59592563 TAAAACACATTCAAAAGAAGGGG + Intergenic
1069607167 10:69746848-69746870 TACATCTCATTAGCAAGAACTGG + Intergenic
1070467217 10:76735608-76735630 CACAATTTATTTCAAAGAACTGG - Intergenic
1070946152 10:80393551-80393573 TACTACTTATTACAAACAACAGG + Intergenic
1072817128 10:98520409-98520431 TACAAACCATTCCCAAGAAATGG + Intronic
1073065164 10:100754261-100754283 TACACCTCCTTTGAAAGAACAGG + Intronic
1074259202 10:111834922-111834944 TCCCACTCATTCCATAGAAAAGG + Intergenic
1074378425 10:112958071-112958093 AACAGCTCATTACAAAGAAGGGG + Intronic
1076427079 10:130374511-130374533 GACATCTCATTCCAGGGAACAGG - Intergenic
1077881241 11:6352254-6352276 TCCACCTCATTCTAAAGATCAGG - Intergenic
1082576481 11:54811527-54811549 AACTGCTCAATCCAAAGAACTGG + Intergenic
1082704217 11:56473508-56473530 TAGAACCCATTCGAAATAACTGG - Intergenic
1087747086 11:101960463-101960485 AACAACTTATTTCCAAGAACAGG + Intronic
1088866788 11:113855338-113855360 TACAGCTCAATCTAAACAACTGG + Intronic
1089377175 11:118002685-118002707 TCCTACTCATTCCACAGAAACGG - Intergenic
1090489435 11:127145303-127145325 CACATCTCATTCCAAATGACAGG + Intergenic
1091088149 11:132743703-132743725 TACACCACATTCCTCAGAACAGG + Intronic
1091092819 11:132788626-132788648 TACAACACATTCTATAGGACAGG + Intronic
1097421329 12:59383575-59383597 TACAATTCATTCCATGGAAAAGG + Intergenic
1107096117 13:36538154-36538176 CAAAACTCATACAAAAGAACAGG + Intergenic
1108121773 13:47195547-47195569 AACAAGTCATTCATAAGAACAGG + Intergenic
1110146844 13:72202519-72202541 TACAATTCCTTCCAGAGCACAGG + Intergenic
1110777677 13:79428784-79428806 GAAAACTCATTCCAAAAAACTGG + Intergenic
1110909336 13:80936059-80936081 TATTAATCATTTCAAAGAACTGG + Intergenic
1111401079 13:87735631-87735653 TACAACTATTTCAAAACAACTGG - Intergenic
1114804298 14:25816732-25816754 TAAAAATTATTCCAAAGACCTGG - Intergenic
1116128068 14:40814679-40814701 TACAACTAATTTCAAATAATTGG - Intergenic
1117676758 14:58163284-58163306 TACAACTCAGTCCATAACACAGG - Intronic
1119172466 14:72545576-72545598 TATAACTCATTCCTTAGAATGGG + Intronic
1120913885 14:89692712-89692734 TACAACACAATCCACTGAACTGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123129070 14:105971460-105971482 TACAACTTGTTCCAAAGAGGTGG - Intergenic
1124810512 15:32932817-32932839 TACAACCGATGCCACAGAACTGG - Intronic
1125824123 15:42661113-42661135 TACAAATCGTTCCAAATGACAGG + Intronic
1126385368 15:48088439-48088461 TACAACTAATTCCAGGGAGCAGG - Intergenic
1127721747 15:61708722-61708744 CACAACTCATTCTCCAGAACAGG + Intergenic
1131278309 15:91000768-91000790 GGGAACTCATTCCAGAGAACTGG - Intronic
1132953784 16:2580167-2580189 CACAAGTCATTCCAATGACCTGG - Intronic
1132960562 16:2619996-2620018 CACAAGTCATTCCAATGACCTGG + Intergenic
1135319173 16:21480157-21480179 AACACCTCATTCCAGAGGACTGG + Intergenic
1135372069 16:21911950-21911972 AACACCTCATTCCAGAGGACTGG + Intergenic
1135439717 16:22458754-22458776 AACACCTCATTCCAGAGGACTGG - Intergenic
1136329472 16:29562230-29562252 AACACCTCATTCCAGAGGACTGG + Intergenic
1136444101 16:30301937-30301959 AACACCTCATTCCAGAGGACTGG + Intergenic
1139395289 16:66633922-66633944 TAGAACGGATCCCAAAGAACAGG + Intronic
1139435281 16:66933297-66933319 TCCAATTCTATCCAAAGAACTGG + Intronic
1139814290 16:69655716-69655738 TACAACTCCTTGCAAAGAAGTGG + Exonic
1139874870 16:70137691-70137713 TACAAATCACTCAAGAGAACTGG - Intronic
1140242335 16:73214418-73214440 TACAATTCATTGCAAAAAAAAGG + Intergenic
1140360916 16:74343451-74343473 TACAAATCACTCAAGAGAACTGG + Intergenic
1140469517 16:75206365-75206387 TACAACTGAGTCCAATGAACTGG + Intronic
1140816938 16:78629793-78629815 TTGAACTCATTCCAAAAAAGTGG + Intronic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1148668722 17:49394192-49394214 TATAACTTAGTCCAAATAACAGG - Intronic
1150034636 17:61781090-61781112 TAAAACTCATTTGAAAGAGCTGG + Intronic
1158794340 18:60824672-60824694 TACACCTCATTCCCTAGAAGCGG - Intergenic
1159454839 18:68648189-68648211 TACAACACATGGTAAAGAACTGG + Intergenic
1159999843 18:75006632-75006654 TACAACAAATTTCAAAGAACTGG - Intronic
1167692655 19:50996291-50996313 GACCAATCATGCCAAAGAACTGG - Intronic
926310933 2:11675793-11675815 CACAACTCAATCTATAGAACAGG - Intergenic
926501777 2:13663447-13663469 TACAAGTCTTTCCAATGAAGAGG - Intergenic
927133147 2:20077662-20077684 TGCAGCTCATTACAAAAAACTGG + Intergenic
929180072 2:39028675-39028697 TAAAACCTATTCCATAGAACAGG + Intronic
932032199 2:68201063-68201085 TACATCTTATTCAAAAGATCTGG + Intronic
932656434 2:73614728-73614750 TCCAACTTATTCCTATGAACTGG - Intergenic
932943701 2:76201528-76201550 AATAACTAATTGCAAAGAACAGG + Intergenic
934707759 2:96496782-96496804 TAGAAATCATTCCAAAGTATTGG + Intergenic
935330789 2:101976030-101976052 TATAACTTATTCCAAATTACAGG - Intergenic
935733604 2:106087581-106087603 TTCAACACATTTAAAAGAACTGG - Intergenic
937695769 2:124806866-124806888 TACAAAACAGACCAAAGAACAGG + Intronic
940752790 2:157646156-157646178 TAGAAATCAATTCAAAGAACAGG - Intergenic
942549165 2:177096631-177096653 TCCAACTCAATCCAAATAAATGG - Intergenic
943747992 2:191482481-191482503 TATAGCTCTTCCCAAAGAACTGG - Intergenic
946357499 2:219197434-219197456 TATAGCACATTCCAAAGAATGGG - Intronic
948759643 2:240182796-240182818 TGCAACTCCTTCCAGAAAACAGG + Intergenic
1170795601 20:19544228-19544250 TAAAAGCAATTCCAAAGAACAGG + Intronic
1171176567 20:23054550-23054572 TAAAACTCTTTCCCAAAAACTGG + Intergenic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1172358130 20:34293766-34293788 TGGATCTCTTTCCAAAGAACTGG - Intronic
1174865789 20:54134409-54134431 GATAACTCATACCAAAGGACAGG - Intergenic
1178390957 21:32197873-32197895 TGCATCTAATTCCAAAGAAATGG + Intergenic
950131560 3:10550746-10550768 TGCAACTCGTTCCATAGACCGGG - Intronic
951675870 3:25241148-25241170 TACAACTGATACCACAGAAATGG - Intronic
952999642 3:38920790-38920812 TGCAAATCATTACAAAGAAGTGG + Intronic
953444616 3:42952270-42952292 AGCAAATCATTCCAAAGAAAGGG - Intronic
957115912 3:76026380-76026402 TATAACTTATTCCTAAGAAAGGG - Intronic
960148329 3:114226783-114226805 TACAACCCATGCCAAAGACTTGG + Intergenic
963037607 3:141046070-141046092 TGCAAATCATTCCAAGGAAATGG + Intergenic
963312815 3:143727405-143727427 TAGAACCCATTCCAATGACCTGG + Intronic
963726488 3:148927727-148927749 CACAACTTCTTCCACAGAACAGG - Intergenic
965895396 3:173569832-173569854 TAGAATACATTCCAAAGAAATGG - Intronic
966106917 3:176346928-176346950 TACAAACCCTTCCAGAGAACAGG + Intergenic
970655651 4:18227678-18227700 AACAACTCAATCAAAAGACCAGG - Intergenic
970684658 4:18553200-18553222 AACAACTGACTCCAAAGAAATGG - Intergenic
972818627 4:42673493-42673515 TCCAACTGATTCCAAAGAAAAGG - Intergenic
978697556 4:111600464-111600486 TCCAACACATCCCAAAGAAAGGG - Intergenic
980436508 4:132782556-132782578 TCCAATTCATTCCAAATAATAGG + Intergenic
980798657 4:137718389-137718411 TACAACTCAGTCCACAGCAGAGG + Intergenic
981999857 4:151012335-151012357 CACAGCACATTCTAAAGAACAGG + Intronic
982511783 4:156291383-156291405 TAAAACTCATTCCAATGCACAGG + Intergenic
983339756 4:166445027-166445049 TACAACTCATTGTCAAGAAATGG - Intergenic
984196986 4:176669894-176669916 AACACCTAACTCCAAAGAACAGG + Intergenic
984380326 4:178984862-178984884 TACAATGTATTTCAAAGAACTGG + Intergenic
986843860 5:11730396-11730418 TTCAATTCATTACAAAGAAGAGG - Intronic
988280187 5:29135048-29135070 TACAAATCATTCTACAGAACTGG - Intergenic
989800515 5:45532903-45532925 TACAAAACATTCCAAGGAATAGG + Intronic
993419257 5:87680247-87680269 TACAAGTCTTTTCAAAGAGCTGG + Intergenic
993770605 5:91919950-91919972 AACAAATCCTTCCAAAGAATAGG - Intergenic
994635023 5:102334000-102334022 TACAAATCATACAAAAGAATAGG + Intergenic
994728065 5:103459810-103459832 TACACATCATTCCAAAGCACTGG - Intergenic
995212564 5:109557432-109557454 AAGAACTCATTACAAAGAGCAGG + Intergenic
997752961 5:136366673-136366695 TACAAATAACTCCAAAGAGCTGG + Intronic
998553297 5:143098425-143098447 TACTAATTATTCCCAAGAACTGG - Intronic
999921452 5:156325994-156326016 GGCAACTTATTCTAAAGAACTGG - Intronic
1003753221 6:9085987-9086009 TAGAACTCATTTTTAAGAACTGG - Intergenic
1004845906 6:19641555-19641577 AGGAACTCATTTCAAAGAACTGG + Intergenic
1006861463 6:37174221-37174243 TACAACTCATTCCAGATCCCAGG + Exonic
1007271282 6:40639176-40639198 TAAAACTCATTCCAGGAAACAGG - Intergenic
1007348536 6:41251418-41251440 TTAAACTCATTCCAAATAAATGG - Intergenic
1007969927 6:46041401-46041423 TATACCTCAGTCCAAATAACTGG + Intronic
1008040445 6:46792219-46792241 TACAAATCAATAAAAAGAACAGG - Intergenic
1008438138 6:51500066-51500088 TACAACTGATTCCAAAGTTGTGG + Intergenic
1008894111 6:56532306-56532328 TGCTACTCTTTCAAAAGAACTGG + Intronic
1009330052 6:62407579-62407601 TAGAAATCATTCCAAAGCCCTGG + Intergenic
1010405393 6:75499796-75499818 TTCATCTCTTTCCAAAGAGCTGG + Intergenic
1011176018 6:84561091-84561113 TGCAATTCAGTCGAAAGAACAGG + Intergenic
1013306971 6:108857446-108857468 AACAACTCTTTCCAGATAACAGG - Intronic
1013743881 6:113321490-113321512 TACAACTCTTTCCACAGATTAGG - Intergenic
1013767121 6:113587996-113588018 TACAACTCATGAAAAAGAATAGG + Intergenic
1014261244 6:119220426-119220448 TACAAGTCATTCTAAAGAGAAGG - Intronic
1015079560 6:129207153-129207175 TACAGCTATTTCCAAAGAAACGG + Intronic
1017593974 6:156008755-156008777 TACAATGGACTCCAAAGAACTGG + Intergenic
1019094959 6:169571857-169571879 TACAACACACACCAAAGAGCAGG + Intronic
1019761798 7:2818457-2818479 TACAACTTATAATAAAGAACAGG + Intronic
1020663282 7:11007473-11007495 TAAAACTCAATCCAAAGAAAGGG + Intronic
1020948036 7:14640073-14640095 TAGAACTCATTCCAGTGAAAGGG - Intronic
1021160702 7:17270266-17270288 AATAACTGATTCCAAAGAAATGG - Intergenic
1021285748 7:18779136-18779158 TACAACTGATCCCAAAGGAATGG + Intronic
1023573019 7:41592212-41592234 TGCAACTCCTTCCAGAGAACTGG - Intergenic
1024295725 7:47840563-47840585 TACACCTCAAAACAAAGAACAGG + Exonic
1024330682 7:48151803-48151825 TCCACCTCTTTCCATAGAACTGG - Intergenic
1025309971 7:57922205-57922227 AACTACTCATTCAAAAGAAAGGG - Intergenic
1028061081 7:86317061-86317083 TACAGCTAATTACAAAGATCAGG + Intergenic
1028481317 7:91309131-91309153 TAAAACTTATGCCAGAGAACAGG + Intergenic
1030816346 7:114042339-114042361 AACAACTCATATCAAAGAAATGG + Intronic
1031357277 7:120802226-120802248 CACAGGTGATTCCAAAGAACAGG + Intronic
1031946367 7:127845589-127845611 TACAACTGACTCCTAAGAAGTGG - Intronic
1033010979 7:137622431-137622453 TCCAACTTATTCAAAAGAATAGG + Intronic
1033546857 7:142409143-142409165 TAGAACTCATTCTAAAGTACTGG + Intergenic
1033788112 7:144758444-144758466 TACCACACCTTCTAAAGAACTGG + Intronic
1035007411 7:155676721-155676743 TTCAACACATCCTAAAGAACTGG - Intronic
1035196186 7:157222706-157222728 TAAAACTCATTTCAAGGAGCTGG - Intronic
1036018009 8:4807562-4807584 AACAACCCATTCCAAAGCTCAGG - Intronic
1038177768 8:25196832-25196854 TACAACTCATTCCAAAGAACTGG - Intronic
1041896746 8:62933689-62933711 AACATCTAATTCCAAAGATCTGG + Intronic
1042814924 8:72867964-72867986 TACCAATCATTTCAAAGAACTGG - Intronic
1045890784 8:107154601-107154623 TTCAATACATTCCAAAGAAGGGG + Intergenic
1046485036 8:114875993-114876015 TACAACTCATTCAAAATCTCTGG + Intergenic
1046622743 8:116545393-116545415 TACAATTCAGTCCAAACAGCTGG + Intergenic
1050043132 9:1516214-1516236 CACAACTCCCTCCAAAGAAATGG - Intergenic
1051057275 9:13002605-13002627 GACAAATCTTTTCAAAGAACAGG + Intergenic
1051137741 9:13942008-13942030 TTCAACTCATTTCAAAGCAGAGG + Intergenic
1053263101 9:36688355-36688377 TATAAATCATTGCAAAGAATAGG - Intergenic
1057529990 9:95836598-95836620 TACAAATAATTCCAATGAACAGG + Intergenic
1057884489 9:98819659-98819681 TAGAACTCATTCCAGGGAAGAGG + Intronic
1062482471 9:136758986-136759008 TACTCCTCATTTCAAAGATCAGG - Intergenic
1186758432 X:12697943-12697965 TACAAGGCATTTCAAAGAAGAGG - Intronic
1186773819 X:12844278-12844300 TCCATGTCATTACAAAGAACAGG + Intergenic
1188110238 X:26189386-26189408 TATAAATCCTTTCAAAGAACTGG - Intergenic
1194941165 X:100012083-100012105 TACATTTCATTCCCAAGAAAAGG - Intergenic
1195270991 X:103230929-103230951 TAGAACTAGTTCCAAAGAACAGG - Intergenic
1195373160 X:104200314-104200336 TACAACTCACACCAAGAAACTGG + Intergenic
1195675943 X:107507161-107507183 GCCAACTCACTCCAAAGACCAGG - Intergenic
1196315530 X:114218174-114218196 TACAACTTCAGCCAAAGAACAGG - Intergenic
1196906266 X:120439036-120439058 TACCACCCATTCTAAAGAGCTGG + Intronic
1198323371 X:135542140-135542162 TCCAATTCATTGCAAAGAATAGG + Intronic
1199085489 X:143624423-143624445 TCCAACTGATTCAAAAGAATGGG + Exonic
1199884356 X:152004616-152004638 TACAAATCATTTCAGAAAACAGG - Intergenic