ID: 1038178671

View in Genome Browser
Species Human (GRCh38)
Location 8:25205571-25205593
Sequence TCAAATCCCTGTAAAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038178671 Original CRISPR TCAAATCCCTGTAAAAGAGG AGG (reversed) Intronic
901779569 1:11584626-11584648 TCCACTCCCTGAAAAAGAGGTGG + Intergenic
903378766 1:22882857-22882879 TCAAATCTCTGTCGAAGAAGAGG - Intronic
906045703 1:42829403-42829425 TCAAATCCTTTCCAAAGAGGAGG - Intronic
909147446 1:71954526-71954548 TCATATACCTGAAAAAAAGGAGG + Intronic
911298868 1:96149721-96149743 TGCAAACCCTGAAAAAGAGGTGG + Intergenic
913230974 1:116740660-116740682 CAAAAGCCCTGTCAAAGAGGAGG - Intergenic
913469410 1:119174109-119174131 CAAAAACCCTGAAAAAGAGGTGG + Intergenic
914460502 1:147878881-147878903 TCTAATCCCTGAAAAAGGTGAGG - Intergenic
916432049 1:164739693-164739715 TCCAATCCCAGAAAAAGAGACGG - Intronic
917227474 1:172800208-172800230 TGCAAACCCTGAAAAAGAGGTGG + Intergenic
918115625 1:181494203-181494225 TAAAATCCCTGCAAGGGAGGGGG + Intronic
920427393 1:205889158-205889180 ACAATTTCCTGTTAAAGAGGTGG - Intergenic
920817716 1:209350534-209350556 TCATAATCCTGTAAGAGAGGTGG + Intergenic
923989523 1:239420253-239420275 TGAAATCCTTGTAAATAAGGAGG - Intronic
924867183 1:247996264-247996286 TCAAATGTTTGTAAAAGAGCAGG - Intronic
1063313251 10:4976380-4976402 GCAATTCCATGTGAAAGAGGTGG - Intronic
1063314703 10:4991362-4991384 GCAATTCCATGTGAAAGAGGTGG + Intronic
1064678280 10:17783405-17783427 TCAGCTCCCTGCAAAGGAGGCGG + Intronic
1065902426 10:30220623-30220645 CAAAACCCCTGTAACAGAGGAGG - Intergenic
1067900325 10:50233592-50233614 TGAAATCTCTTTAAAAGAGCAGG + Intronic
1068000830 10:51332101-51332123 TCAAATCCCTTTAAAAAATATGG + Intronic
1070148398 10:73790960-73790982 TCACATCACTGTAAAAGCAGAGG - Exonic
1071834763 10:89408174-89408196 TGCAAACCCTGAAAAAGAGGTGG + Intronic
1072129798 10:92483397-92483419 TCAAATCACTCTTCAAGAGGAGG + Intronic
1073957090 10:108884941-108884963 TCAAATCTCTTTATAAGAGTTGG + Intergenic
1074615804 10:115067066-115067088 TAAAATCCATGTAAAAAAGTTGG - Intergenic
1077663780 11:4091267-4091289 TCAAATCCCTGCAAGACATGGGG - Exonic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1083925644 11:65804369-65804391 CCACAGCCCTGTAAGAGAGGTGG + Intergenic
1086317299 11:85608288-85608310 CAAAAACCCTGAAAAAGAGGTGG + Intronic
1087081962 11:94179440-94179462 TAAAATCCGTTTAAAAGAGGAGG - Intronic
1087140874 11:94764785-94764807 TCAAATTACTGGAGAAGAGGAGG + Intronic
1087279084 11:96190412-96190434 ACAAATCCATCTAAAAGAGGTGG - Intronic
1088417232 11:109602793-109602815 TCAAATCCCTGGAAATTTGGGGG - Intergenic
1088492455 11:110401182-110401204 TGCAAACCCTGAAAAAGAGGTGG + Intergenic
1089004569 11:115080537-115080559 TAAAATACCTATAACAGAGGTGG - Intergenic
1090399351 11:126439065-126439087 TCAAATCCATCTAAAACTGGAGG - Intronic
1091573999 12:1715371-1715393 TGCAAACCCTGAAAAAGAGGCGG - Intronic
1092297306 12:7210591-7210613 TCAATTCCCAGTAAAAGTGGGGG - Intronic
1094195832 12:27748981-27749003 TCAATTCCTTTTCAAAGAGGTGG - Intronic
1095321140 12:40828676-40828698 TCAAATTCTAGTAAAAGATGTGG + Intronic
1096080948 12:48832078-48832100 CCAAATCCCTGGAGAAGATGGGG - Exonic
1096601407 12:52732444-52732466 CCAAATCCCTGGAGAAGATGGGG + Intergenic
1099347309 12:81518235-81518257 TCAAGTCATTGTAAAAGAGATGG - Intronic
1099576944 12:84393807-84393829 TGAAAACCCTGAAAAAGAGGTGG - Intergenic
1099697801 12:86043734-86043756 TGACATCCCTGAAAGAGAGGGGG - Intronic
1100744926 12:97635279-97635301 TCAAATCTATTTAAAATAGGTGG - Intergenic
1100861275 12:98809840-98809862 TCTAAACCATGAAAAAGAGGAGG - Intronic
1101779578 12:107823517-107823539 TGCAAACCCTGAAAAAGAGGTGG + Intergenic
1104100007 12:125598820-125598842 TCAAATTCCCCTAATAGAGGGGG + Intronic
1104154232 12:126115989-126116011 TCAACTCCATGAAAAAGAGGAGG - Intergenic
1106070910 13:26410147-26410169 TAAAATCTTTGTAAAAAAGGAGG + Intergenic
1109793108 13:67275548-67275570 TCAAATCCCGAGAACAGAGGGGG + Intergenic
1110289301 13:73785760-73785782 TGCAATCCCTCTAAAGGAGGTGG + Intronic
1110866868 13:80406335-80406357 TGAAATCCCTGAAAGGGAGGGGG - Intergenic
1112948879 13:104965055-104965077 TCAAATCGCTCTAAAAGACCGGG - Intergenic
1113204005 13:107895517-107895539 TGCAAATCCTGTAAAAGAGGTGG - Intergenic
1113373312 13:109741860-109741882 TAAAATCCCTGAAAGAGAGGAGG - Intergenic
1114238342 14:20842260-20842282 TCAATGGCCTGTAAACGAGGAGG + Intergenic
1116566001 14:46445048-46445070 TGAAATATCTGTAAAAGATGTGG - Intergenic
1118292406 14:64539178-64539200 TCACATTCCTGTTAAACAGGAGG + Intronic
1120096230 14:80391013-80391035 TCAAATTCCTCAAACAGAGGAGG + Intergenic
1122870682 14:104636920-104636942 TCAAATCCCTGGAAGTGAGAGGG + Intergenic
1124078653 15:26470616-26470638 GCAAAGCGCTGTAAAAGAGGTGG - Intergenic
1124228287 15:27916505-27916527 TCAAATCCCTATAAAACAAAAGG + Intronic
1125524516 15:40366755-40366777 CCAACTCCATGTAAAAGTGGAGG - Intronic
1126304298 15:47237591-47237613 TCCAATCCATTTAATAGAGGAGG - Intronic
1126360041 15:47836774-47836796 TCACTTCGCTGAAAAAGAGGGGG - Intergenic
1126915713 15:53464070-53464092 TTAACTCACTGTAAAAGTGGAGG + Intergenic
1133704223 16:8337950-8337972 TCAAATCCCTGTAGAAGAATGGG + Intergenic
1134054622 16:11161956-11161978 TTAAAGACCTGTAGAAGAGGAGG + Intronic
1134520601 16:14917718-14917740 TTATATCCCTGGAAGAGAGGGGG - Intronic
1134550973 16:15138256-15138278 TTATATCCCTGGAAGAGAGGGGG + Intronic
1134644392 16:15854850-15854872 TCAAACCTCTGAATAAGAGGGGG + Intronic
1134708273 16:16316369-16316391 TTATATCCCTGGAAGAGAGGGGG - Intergenic
1134715488 16:16356402-16356424 TTATATCCCTGGAAGAGAGGGGG - Intergenic
1134951329 16:18352276-18352298 TTATATCCCTGGAAGAGAGGGGG + Intergenic
1134959269 16:18395757-18395779 TTATATCCCTGGAAGAGAGGGGG + Intergenic
1135291984 16:21247720-21247742 TCAAGTCCTTGTAGGAGAGGAGG + Intronic
1138918653 16:61499845-61499867 CTAAATCCCTGTAAGAGAAGGGG - Intergenic
1142111065 16:88331935-88331957 TCATATTCCTGTGAATGAGGAGG - Intergenic
1144715139 17:17429322-17429344 ACAAATCTTTGTTAAAGAGGAGG - Intergenic
1144855436 17:18264815-18264837 TCAAATCCCTGGAAGGGAGGTGG - Exonic
1145768722 17:27477409-27477431 TCAGTTCCCTGTATAATAGGAGG - Intronic
1146533147 17:33627736-33627758 TCAAATCCCTGAAAAATATTAGG - Intronic
1146689975 17:34866614-34866636 TCAAATCCCTGTTCCTGAGGGGG - Intergenic
1148063716 17:44853628-44853650 CCGAATCACTGTAAAGGAGGTGG + Exonic
1148192620 17:45690225-45690247 TCAAAACTCCGTAAAAGAGAGGG + Intergenic
1149064258 17:52461364-52461386 TCAAAGCCCTGGAAAAGACAGGG + Intergenic
1149155167 17:53620493-53620515 TCAAATCGTAGTAAAAGATGTGG + Intergenic
1152416885 17:80168480-80168502 GCCATTCCCAGTAAAAGAGGGGG - Intergenic
1153073980 18:1141718-1141740 TCCTATCCCTGCAGAAGAGGAGG - Intergenic
1153651849 18:7248020-7248042 TCAAATCCCTCTGAAGGAGGGGG + Intergenic
1154979970 18:21495599-21495621 TCAGAAGCCTGTAAAAAAGGTGG + Intronic
1155260044 18:24032851-24032873 ACAAACCCCTGTATAAAAGGGGG - Intronic
1155771802 18:29711249-29711271 TCACATCCCTGTAAGGCAGGTGG + Intergenic
1159303676 18:66611900-66611922 TAAAACCCCTGTAAATGATGGGG - Intergenic
1162821813 19:13227700-13227722 TCAAATCAATGGAAAAGAGGAGG + Intronic
1164406851 19:27956709-27956731 TTAAAGCACTGTATAAGAGGAGG - Intergenic
1165705203 19:37971027-37971049 ACAACTGCCTGAAAAAGAGGAGG - Intronic
1167349656 19:48966532-48966554 CCCAATCCCTGGAAAAGAGGGGG - Intronic
1168391876 19:56015727-56015749 TGAAATTCCTGCAAAAGAGAAGG - Exonic
925328103 2:3038392-3038414 TCAAATCAATTTAAAGGAGGTGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
929330279 2:40673949-40673971 TGCAAACCCTGAAAAAGAGGTGG + Intergenic
935220757 2:101010442-101010464 TCAAATCGCTTCAAAACAGGAGG - Intronic
937362871 2:121241159-121241181 AAAATTCCCTGTAAAAAAGGAGG + Intronic
939851760 2:147313172-147313194 TGCAAACCCTGAAAAAGAGGTGG + Intergenic
945291923 2:208135335-208135357 CCTAATCCCTGTAATACAGGAGG - Intergenic
945714207 2:213337121-213337143 CAACATCCCTGTAGAAGAGGGGG + Intronic
946190338 2:218004438-218004460 GCAGATCCCTGTGAAAGAGGAGG - Intergenic
947253064 2:228130192-228130214 TTATTTCCCTGGAAAAGAGGTGG - Intronic
948902146 2:240962244-240962266 TAAAATTCCTGTAAAAGGGATGG + Intronic
1169818594 20:9684765-9684787 TAGAATTCCTGGAAAAGAGGAGG - Intronic
1172995152 20:39064853-39064875 TCCAAGCCTTGTTAAAGAGGAGG - Intergenic
1173907856 20:46641874-46641896 TGAGATCCCTCAAAAAGAGGTGG - Intronic
1175551097 20:59818254-59818276 TCACATCCCTTTTACAGAGGAGG - Intronic
1178253073 21:31023235-31023257 TCAGAGCCCAATAAAAGAGGTGG - Intergenic
1178488305 21:33032561-33032583 CCAACTCCCTGTAAGTGAGGAGG + Intergenic
1182321042 22:29478862-29478884 TCACTTCCCTGTAAGAGAGAAGG + Intergenic
951900116 3:27648725-27648747 TGAAATCCCTAGAAAAAAGGAGG - Intergenic
952668368 3:35935535-35935557 TCAAATCCATGGAACAGGGGCGG + Intergenic
956342503 3:68241690-68241712 TCCATTGCCTGGAAAAGAGGAGG - Intronic
959978860 3:112492354-112492376 TGAAATCCCTGTGACAAAGGTGG - Intronic
960203383 3:114865530-114865552 TCAAATCCATGTATAGGAGGTGG - Intronic
961157436 3:124692011-124692033 TCAGTTCCCTGGAATAGAGGGGG + Intronic
963292451 3:143505506-143505528 TCCAGTCCCTGTAGTAGAGGAGG + Intronic
963409306 3:144908037-144908059 TGCAAACCCTGAAAAAGAGGCGG - Intergenic
963696638 3:148572634-148572656 GCAAAACCCTGAAAAAGAGGTGG + Intergenic
964435334 3:156645451-156645473 TCAAAACCCTGGATATGAGGAGG + Intergenic
967333141 3:188312701-188312723 TCAAATCAGTGTGAAAGAGATGG - Intronic
967678518 3:192330579-192330601 ACAAATCTCTGCATAAGAGGAGG + Intronic
970848106 4:20567306-20567328 TCAAATCCGTGTAAAAATGATGG + Exonic
971151229 4:24033808-24033830 TCAAATGGCTGGAAGAGAGGCGG + Intergenic
974795465 4:66743220-66743242 TCAAGTCTCTGAACAAGAGGAGG - Intergenic
976972713 4:91127182-91127204 ACAAATCCCTGTGATAGTGGTGG + Intronic
979388215 4:120095280-120095302 TCTAATGCCCTTAAAAGAGGAGG + Intergenic
983271620 4:165568735-165568757 TCAATTTCCTGTAAAAGGGAAGG + Intergenic
983869209 4:172805318-172805340 TAAAATCTCTGAAAAAAAGGAGG + Intronic
984268010 4:177517094-177517116 TCAAGTCCCTCTAAAAGTAGGGG - Intergenic
984588131 4:181586512-181586534 TCAAATCCCAGTTCAAGTGGTGG + Intergenic
984917338 4:184736245-184736267 CATAAACCCTGTAAAAGAGGTGG + Intergenic
986230290 5:5858130-5858152 TCAATTCCCTGAAAAATATGAGG - Intergenic
986848003 5:11778358-11778380 TCAAAGCCATTTGAAAGAGGTGG - Intronic
987009704 5:13749706-13749728 TCAAATACCAGTGACAGAGGTGG + Intronic
989363720 5:40633053-40633075 TTAAATCCCTGTCAACCAGGTGG + Intergenic
990260454 5:54016294-54016316 CGAAATCCCTGTGAAAGAGATGG + Intronic
991450030 5:66741918-66741940 TAAAATCCCTGTATAAGGAGAGG + Intronic
995826254 5:116303001-116303023 TCAAATACGTTTAAAAAAGGAGG - Intronic
998958273 5:147459050-147459072 TCCAAGCACTGTAAAAGAGCTGG - Intronic
999708826 5:154298185-154298207 ACAAATGCCTGTGAAAGAGGAGG - Intronic
1000014421 5:157265416-157265438 GCAGGCCCCTGTAAAAGAGGTGG + Intergenic
1001119183 5:168965021-168965043 TCACATCCCTGAAAGAGAGAGGG + Intronic
1005407945 6:25511766-25511788 TCAGAGCCCTGTCAAAGAAGTGG - Intronic
1005692592 6:28321860-28321882 TCAACTCCATTTTAAAGAGGGGG - Intergenic
1005862858 6:29914673-29914695 TCAGATCCCAGTGACAGAGGAGG + Intergenic
1006294134 6:33162377-33162399 TCTAATCTCTGTAAATGGGGAGG - Intergenic
1009874769 6:69492275-69492297 TCACATTTCTTTAAAAGAGGTGG - Intergenic
1014763462 6:125384108-125384130 AAAAATACATGTAAAAGAGGAGG - Intergenic
1017436726 6:154422498-154422520 CCAGATACCTGTACAAGAGGTGG + Exonic
1018546141 6:164938139-164938161 CAAAATCTCTGTAAAAGAAGTGG + Intergenic
1019027394 6:168979736-168979758 TCGAATCCCTGTTAATGTGGTGG - Intergenic
1022774816 7:33515654-33515676 GCAAATCCCTGAAATAGATGTGG - Intronic
1023989029 7:45117206-45117228 TCAGATTCCTGCATAAGAGGAGG + Intergenic
1024449336 7:49521140-49521162 TCAAGTCCCTGTGAATGATGTGG - Intergenic
1024705331 7:51952129-51952151 ACATATCCCTGTGAAAGTGGTGG + Intergenic
1025228297 7:57182022-57182044 GCTCACCCCTGTAAAAGAGGAGG - Intergenic
1025228361 7:57182327-57182349 GCTCATGCCTGTAAAAGAGGAGG - Intergenic
1027254383 7:76421784-76421806 TGAAATTCCTGCAAGAGAGGAGG - Intronic
1029185125 7:98732866-98732888 TGAAATCCCTGGGAAAGAGGTGG - Intergenic
1030230438 7:107203179-107203201 TCATATCCCTTTAAAAGAAGTGG + Exonic
1031605824 7:123766384-123766406 TCAAAACCCAGTAAGAGATGTGG + Intergenic
1032801850 7:135323070-135323092 TCAAAGCCCTGGAGAAGAGGAGG - Intergenic
1033335622 7:140449812-140449834 TCAAATATCTGTAAAATATGTGG + Intergenic
1034986037 7:155516023-155516045 TTTAATCTGTGTAAAAGAGGAGG - Intronic
1037347506 8:17915629-17915651 TCAAACTCCTCTTAAAGAGGGGG - Intergenic
1037758123 8:21724556-21724578 ACAAAGCCCTGTAAACCAGGAGG + Intronic
1038178671 8:25205571-25205593 TCAAATCCCTGTAAAAGAGGAGG - Intronic
1038699046 8:29832552-29832574 TGAAAGCCCTGTAGAGGAGGTGG + Intergenic
1041701812 8:60798472-60798494 TCAAATCCCTTTTTAAGAGCAGG + Intronic
1045750865 8:105482719-105482741 ACAAATTCATGTAAAATAGGAGG - Intronic
1045818978 8:106312500-106312522 TCAATTCACTGTGGAAGAGGTGG + Intronic
1045883990 8:107074515-107074537 TCAAATCTCCGGAAAAGGGGAGG - Intergenic
1046428893 8:114095569-114095591 TCAAAGCCCTGTCAATGATGAGG - Intergenic
1046536028 8:115511584-115511606 TAAAATCCCTGTGACAGAGTTGG + Intronic
1046558539 8:115808142-115808164 TCAAGTCTGTGTAAAATAGGAGG + Intronic
1047021882 8:120784298-120784320 TCAAATCCCTTTAAAAAAAATGG - Intronic
1048762220 8:137807479-137807501 ACATATCCCTGTGAAAGAAGAGG + Intergenic
1049250967 8:141588815-141588837 TCAAATCCCAGCAAAATGGGAGG + Intergenic
1050456093 9:5835938-5835960 TCAAATCCCTGATAAGGATGAGG + Intergenic
1051871002 9:21737609-21737631 TTGAATCCTTGAAAAAGAGGTGG - Intergenic
1055131467 9:72779789-72779811 TGACATCCCTGAAAGAGAGGGGG + Intronic
1055716914 9:79127833-79127855 TCATTGCCCTTTAAAAGAGGAGG + Intergenic
1056086003 9:83149769-83149791 TCACTGCCCTGTAGAAGAGGGGG - Intergenic
1056276287 9:84997508-84997530 TCAAATCCCTGTACCAGAAAAGG + Intronic
1059868316 9:118542536-118542558 TCAATTCCCTATAAATGAGCAGG - Intergenic
1191206066 X:57835201-57835223 TGCAAACCCTGAAAAAGAGGTGG - Intergenic
1192197063 X:69035449-69035471 TCAAATAACAGAAAAAGAGGAGG - Intergenic
1196148311 X:112344254-112344276 TAAATCCTCTGTAAAAGAGGTGG - Intergenic
1198110686 X:133500250-133500272 TCAAATCCTTATCAAAGAGAAGG + Intergenic
1200695090 Y:6351634-6351656 ACAAATCCTTGACAAAGAGGTGG - Intergenic
1200764338 Y:7067717-7067739 TCTGATTCCTGTAGAAGAGGAGG + Intronic
1200801146 Y:7388075-7388097 TGCAAACCCTGAAAAAGAGGTGG - Intergenic
1201040187 Y:9823076-9823098 ACAAATCCTTGACAAAGAGGTGG + Intergenic
1201312179 Y:12606913-12606935 ACCAAACCCTGAAAAAGAGGTGG - Intergenic