ID: 1038179394

View in Genome Browser
Species Human (GRCh38)
Location 8:25212440-25212462
Sequence GGCCACGGGCAAGTTTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038179388_1038179394 4 Left 1038179388 8:25212413-25212435 CCAACTGTGGGCCAACAGTGTGC 0: 1
1: 0
2: 1
3: 15
4: 208
Right 1038179394 8:25212440-25212462 GGCCACGGGCAAGTTTCATGTGG No data
1038179391_1038179394 -7 Left 1038179391 8:25212424-25212446 CCAACAGTGTGCTAAGGGCCACG 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1038179394 8:25212440-25212462 GGCCACGGGCAAGTTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038179394 Original CRISPR GGCCACGGGCAAGTTTCATG TGG Intronic
No off target data available for this crispr