ID: 1038179576

View in Genome Browser
Species Human (GRCh38)
Location 8:25213855-25213877
Sequence TTGATTAGTAAACCTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038179570_1038179576 18 Left 1038179570 8:25213814-25213836 CCTCTTTAGATGCAATAAGAGAT 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1038179576 8:25213855-25213877 TTGATTAGTAAACCTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038179576 Original CRISPR TTGATTAGTAAACCTGTTAC AGG Intronic
No off target data available for this crispr