ID: 1038184106

View in Genome Browser
Species Human (GRCh38)
Location 8:25257248-25257270
Sequence GCTCGATGCCTGGCATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038184106_1038184111 19 Left 1038184106 8:25257248-25257270 CCTCTCTATGCCAGGCATCGAGC 0: 1
1: 0
2: 4
3: 25
4: 199
Right 1038184111 8:25257290-25257312 CCTCTCAGTTCTTACAATCCTGG No data
1038184106_1038184112 20 Left 1038184106 8:25257248-25257270 CCTCTCTATGCCAGGCATCGAGC 0: 1
1: 0
2: 4
3: 25
4: 199
Right 1038184112 8:25257291-25257313 CTCTCAGTTCTTACAATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038184106 Original CRISPR GCTCGATGCCTGGCATAGAG AGG (reversed) Intronic
900243079 1:1626019-1626041 GGTGGATGCTTGGCCTAGAGTGG + Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902870485 1:19311265-19311287 AGTCAAAGCCTGGCATAGAGTGG + Intronic
903361901 1:22782270-22782292 ACACAATGCCTGGCATAGATTGG + Intronic
905996708 1:42387595-42387617 GTACAATGCCTGGCACAGAGTGG - Intronic
906151487 1:43590389-43590411 GCACAATGTCTGGCATTGAGTGG + Intronic
908011429 1:59781821-59781843 GCACAGTGCCGGGCATAGAGTGG - Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
908954981 1:69613649-69613671 GCACAATGACTGGCATACAGTGG + Intronic
909501878 1:76343951-76343973 GCTCAATGCCTGACATCTAGTGG - Intronic
911698839 1:100926750-100926772 GCTATTTGCCTGGCACAGAGTGG - Intronic
914914994 1:151814212-151814234 GCACAATGCCTGGCAGAGAAGGG + Intronic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
916040556 1:160957609-160957631 GCACAATGCCTGGCACACAGTGG + Intergenic
918371499 1:183866257-183866279 GCACAATGCCTGGCAGACAGTGG - Intronic
918958798 1:191243635-191243657 GCTTGATGCCAGGCATTGAAAGG + Intergenic
919666695 1:200299646-200299668 TCTCCAGGCCAGGCATAGAGTGG + Intergenic
920271525 1:204768427-204768449 GCTCACAGCCTGGCGTAGAGAGG + Intergenic
920300998 1:204988883-204988905 GCTGGCTGCCTGGGATGGAGAGG + Intronic
920432625 1:205928443-205928465 GCATGGTGCCTGGCACAGAGTGG + Intronic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
924017863 1:239747267-239747289 GATCAATGCCTGGCAGATAGTGG - Intronic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1065014158 10:21446391-21446413 GTTCAATGCCTGGCACAGTGGGG - Intergenic
1067208712 10:44241208-44241230 GGTGTATGCCTGGCATAGAAGGG - Intergenic
1069930447 10:71878097-71878119 GCTCAGTGCCTGGCACTGAGGGG - Intergenic
1070671420 10:78380191-78380213 GCCCAAAGCCTGGCACAGAGTGG + Intergenic
1072286106 10:93917149-93917171 GCTCAGTGCCTGGCGTAGGGTGG - Intronic
1072489543 10:95890320-95890342 GCTGTATGCCTGGCACATAGAGG + Intronic
1072542662 10:96410227-96410249 GCACCATGCCTGGCATACAGTGG + Intronic
1072633326 10:97161983-97162005 CCCAGGTGCCTGGCATAGAGTGG + Intronic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073559738 10:104486645-104486667 GCTCAGTGCCTGGAATACAGTGG - Intergenic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1074714437 10:116205226-116205248 GCTCAATGTCTGGAATACAGGGG + Intronic
1075640502 10:124060942-124060964 GCTTGATGCCTGCCATAAAATGG - Intronic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1078773650 11:14374369-14374391 GCTCAGTGCCTGGCACATAGAGG + Intergenic
1079479770 11:20866905-20866927 GCTAAATGCCTGGCACAGAGTGG + Intronic
1080445031 11:32330916-32330938 GCACAATGCCTGGCACACAGTGG - Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1081567935 11:44271062-44271084 GCCAGGTGCCTGGCGTAGAGTGG - Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1083638593 11:64133407-64133429 GCTGGCTGCCTTGCATAGGGAGG + Intronic
1083723778 11:64618000-64618022 TCTAGAAGCCTGGGATAGAGAGG - Intronic
1084320303 11:68369893-68369915 GCTGGGTGCCTGGCATCCAGTGG + Intronic
1084619028 11:70255935-70255957 GCCCGGTGCCTGGCATAAAGTGG + Intergenic
1084937335 11:72594132-72594154 ACTCCATGCCTGACATACAGTGG + Intronic
1085295862 11:75431339-75431361 GCTCACTGCCTGGCACAGAAAGG - Intergenic
1085839141 11:79990542-79990564 GCACAATGCTTGGCACAGAGTGG - Intergenic
1086046325 11:82536088-82536110 GCTCATTGCCTGGTACAGAGTGG + Intergenic
1086717398 11:90079197-90079219 GCTCTATGCCTGGCCTTGAAAGG - Intergenic
1087551904 11:99661610-99661632 GCTGGATACCCGGCATAGTGGGG - Intronic
1088214122 11:107489290-107489312 GCACAATGCCTGGCACACAGTGG + Intergenic
1089809260 11:121118241-121118263 GCCCAATGCCTGGCACAGAGGGG + Intronic
1090410884 11:126508858-126508880 GCACAGTGCCTGTCATAGAGTGG + Intronic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1090598371 11:128343503-128343525 ACACGATGCTTGGCACAGAGTGG - Intergenic
1090825690 11:130383996-130384018 GCTTGATCCCAGGCATAGATGGG + Intergenic
1091088363 11:132745817-132745839 GCTCCATGACTGGGATAGAGTGG + Intronic
1096523995 12:52199935-52199957 GCACGGTGCCTGGCATATAGTGG + Intergenic
1096591188 12:52660213-52660235 GCTCTTTGCCTGGCATTGATGGG + Intergenic
1097350844 12:58547050-58547072 GCTGGAGGGCTGGGATAGAGAGG + Intronic
1098613731 12:72495690-72495712 GCACAATATCTGGCATAGAGTGG + Intronic
1098872599 12:75833825-75833847 GCATGGTGCCTGGCACAGAGTGG - Intergenic
1100793364 12:98154367-98154389 GCTCCATGCCTGGCACAGATAGG + Intergenic
1101708705 12:107244765-107244787 GCTCTATGCTTGGCAGAGGGAGG + Intergenic
1101735322 12:107458891-107458913 TTCCCATGCCTGGCATAGAGGGG - Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1102542120 12:113628644-113628666 GCTTGATGCCTGGTATGCAGTGG - Intergenic
1103142281 12:118559151-118559173 GCACAACGCCTGGCACAGAGTGG + Intergenic
1103243563 12:119435550-119435572 GCTCAGTGCTTGGCACAGAGTGG + Intronic
1107462984 13:40622720-40622742 GCTCTATGCCTGGCATAAAATGG + Intronic
1109079718 13:57883385-57883407 GCTCTATGTCTGTAATAGAGGGG - Intergenic
1109228529 13:59726634-59726656 CCTCAATGCCTGGCCAAGAGGGG + Intronic
1112114839 13:96340490-96340512 GCAGAACGCCTGGCATAGAGGGG + Intronic
1113947122 13:114050614-114050636 GCTCTCTGCCTGGCATTGAGAGG - Intronic
1115750180 14:36481619-36481641 GCACAATGCCTGGCACACAGTGG + Intronic
1117527511 14:56624592-56624614 GCACACTGCCTGGCATAGAACGG - Intronic
1119112609 14:71989111-71989133 GCCCAATGCCTGGCACAAAGTGG - Intronic
1121002425 14:90461541-90461563 GCACGATGCTTGGCATCTAGTGG - Intergenic
1121580348 14:95025315-95025337 CCTCGAAGCCTGGCAAAGAAAGG + Intergenic
1122044056 14:99010942-99010964 GCTGGATGCCAGGCAGAGAAAGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1124851647 15:33345252-33345274 GCTCCATGCCTGGCACATAGTGG - Intronic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125156431 15:36591989-36592011 ACTGGATGGCTGGCATAAAGTGG - Intronic
1125639799 15:41221089-41221111 GCATGATGCCTGGCTCAGAGTGG - Intronic
1127010219 15:54617566-54617588 GCACAATGCCTGGCATACATAGG + Intronic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129275284 15:74441414-74441436 GCTCAATGCCTGGCACAGAGAGG + Intergenic
1129954577 15:79623731-79623753 GCTCAGTGCCAGGCATGGAGTGG + Intergenic
1130140424 15:81221589-81221611 CCTCCAGGCCTGGCATCGAGAGG - Intronic
1131757677 15:95583228-95583250 TCTCAGTACCTGGCATAGAGAGG - Intergenic
1134441036 16:14299852-14299874 GCTCTGTGCCTGGCACACAGAGG + Intergenic
1135926434 16:26697887-26697909 GCTGGGTGCCTGGCAGTGAGAGG - Intergenic
1136405046 16:30040327-30040349 GCCTGGTGCCTGGCATACAGTGG - Intronic
1137478154 16:48828745-48828767 GCTGGCTGCCTGGCATAGGGTGG + Intergenic
1140843288 16:78862706-78862728 GCTTGAAGTCAGGCATAGAGAGG + Intronic
1145845289 17:28033204-28033226 GCACAATGCCTGACACAGAGTGG - Intergenic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1147447216 17:40481848-40481870 GCGCAATGCCTGGCATAGAATGG - Intronic
1151330879 17:73407225-73407247 GGCCGATGCCTGGCACAGTGAGG + Intronic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1152663372 17:81553113-81553135 GCTCCATGCCCGGAAGAGAGCGG + Intronic
1152987309 18:332540-332562 TCACGGTGCCTGGCATATAGAGG + Intronic
1155065393 18:22264986-22265008 GCTGGGTGCCGGGCATATAGGGG - Intergenic
1158590651 18:58776045-58776067 GCACAGTGCCTGGCATGGAGTGG - Intergenic
1160027584 18:75231173-75231195 GCCCCAAGCCTGGCACAGAGTGG + Intronic
1160512500 18:79460499-79460521 GCTCCAGGCCTGGCAGAGTGGGG - Intronic
1161470570 19:4455013-4455035 GCCCTAGGCCTGGCATGGAGTGG - Intronic
1161551067 19:4912476-4912498 GCTCGGTGGCTGGCATAGAGTGG - Intronic
1163587529 19:18172287-18172309 GCTTGGTGCCAGGCATAGAGTGG - Intronic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1164986625 19:32653152-32653174 GCACGGTGCCTGGCGTGGAGTGG + Intronic
1166289397 19:41852357-41852379 TGTCTATGCCTGGCACAGAGCGG - Intergenic
1166658329 19:44628330-44628352 CCTCAGTGCCTGGCACAGAGCGG - Intronic
1166698054 19:44865466-44865488 GCCCGAAGCCTGGCAGCGAGCGG + Exonic
1168512797 19:56986960-56986982 GCAGGATGCCTAGCACAGAGTGG + Intergenic
925185416 2:1843328-1843350 GCCCGACGCCTTGCACAGAGCGG + Intronic
926273744 2:11387860-11387882 ACTAGATGCCTGGCACACAGTGG + Intergenic
926748676 2:16181181-16181203 GCCCAGTGCCTGGCATAGAGAGG + Intergenic
928035485 2:27818661-27818683 GCATGATGCCTGGCACAGTGTGG + Intronic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
936059419 2:109284587-109284609 GCTGGATGAAGGGCATAGAGTGG + Intronic
936076378 2:109404343-109404365 GCTCGAGGCCTGGCGGGGAGTGG + Intronic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
938740242 2:134224789-134224811 CCTCCATGCCTGGCCTAGATTGG - Intronic
940885847 2:158988687-158988709 GCACAGAGCCTGGCATAGAGTGG - Intronic
941701935 2:168613077-168613099 GTTTGATGCCTGGGATAAAGGGG + Intronic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1170285638 20:14705365-14705387 GTTCCATGCTAGGCATAGAGGGG - Intronic
1170746731 20:19106174-19106196 GTTTGATGACTGGCATATAGAGG - Intergenic
1172629439 20:36368094-36368116 GCCCCGTGCCTGGCATACAGTGG + Intronic
1172906332 20:38372680-38372702 GCTCTCTGCTTGGCATATAGTGG + Intronic
1174582870 20:51584990-51585012 GCTTGCTGCCTGGCATGGTGGGG + Intergenic
1174813121 20:53664288-53664310 GCAGAATGCCTGGCATACAGTGG + Intergenic
1174830620 20:53808885-53808907 GTTCAGTGCCTGGCACAGAGTGG + Intergenic
1175308459 20:57994316-57994338 GCACGGTGCCCGGCACAGAGCGG + Intergenic
1181978191 22:26747405-26747427 GAACAATGCCTGGCATACAGTGG - Intergenic
1182981495 22:34675556-34675578 GATCCATGCCTGGCAAGGAGTGG + Intergenic
1183043880 22:35204099-35204121 GCACAATGCCTGGCATAGCCAGG + Intergenic
1184457905 22:44621883-44621905 CCTTGCTGCCTGGCATAGTGTGG - Intergenic
949897630 3:8780142-8780164 GCATGATGCCTGGCACATAGTGG + Intronic
950131925 3:10553329-10553351 GTTCCATGCCTGACACAGAGAGG + Intronic
953648840 3:44781121-44781143 GCTCAATGCCTGGCACAGAGTGG + Intronic
956120781 3:65963836-65963858 GCACAATGCCAGGGATAGAGTGG + Intronic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
961198510 3:125024867-125024889 GCTAGGAGCCTGGCATGGAGAGG - Intronic
963025793 3:140917588-140917610 GCTAGATACCTGGCATGTAGTGG + Intergenic
963272416 3:143299039-143299061 GCTCGGTTCCTGGCATACAGTGG + Intronic
963512632 3:146268101-146268123 GCCTAATGCCTGGCACAGAGTGG - Intergenic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966784708 3:183612582-183612604 GCTCTGTGCCTGGCACATAGTGG - Intergenic
968935590 4:3608491-3608513 GCACGATGCTTGGAACAGAGTGG + Intergenic
970133285 4:12894389-12894411 GCATGGTGCCTGGCACAGAGCGG + Intergenic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
972532796 4:39976749-39976771 GTTCGATCCCTGGGAAAGAGCGG - Intronic
974806732 4:66890220-66890242 GCTCACTGTCTGGCACAGAGTGG + Intergenic
976544900 4:86323400-86323422 GCTCAATGCCTGGCACAGATTGG - Intronic
978518026 4:109589781-109589803 GCAGGTTGCCTGGCACAGAGTGG + Intronic
979605555 4:122634841-122634863 GCACAATGCCTGGCATGGAAAGG + Intergenic
984701395 4:182820807-182820829 TCTCCATGCCTGGCATAGAGGGG + Intergenic
984707057 4:182855320-182855342 GCTCAGTGCCTCGCATACAGTGG - Intergenic
987031627 5:13981362-13981384 GCACCGTGCCTGGCTTAGAGTGG + Intergenic
987266521 5:16261991-16262013 GCTCCGTGCATGGCATATAGCGG + Intergenic
990548773 5:56851277-56851299 GCACAATGCCTGGCACACAGGGG - Intronic
990716698 5:58645547-58645569 ACACGATGCCTGGCAAAGGGTGG - Intronic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
993512657 5:88790791-88790813 GCTCAATGCCTAGCATATTGTGG - Intronic
997749312 5:136329308-136329330 TCTCAGTGCCTGGCATACAGTGG - Intronic
998508528 5:142691793-142691815 TGACGATGCCTGGCATATAGTGG + Intronic
998850105 5:146343975-146343997 GCTCAAGGTCTGGCCTAGAGTGG + Intergenic
999046185 5:148472267-148472289 GCACAATGCCTGGCACACAGTGG + Intronic
999099318 5:149009533-149009555 GCTCAGTGCCTGGCACAGACTGG + Intronic
1000251305 5:159498067-159498089 GCTCCTTGCCTGGCACAAAGAGG - Intergenic
1000670106 5:164050976-164050998 GCACAGTGCCTGGCATGGAGTGG + Intergenic
1001871611 5:175160977-175160999 GCATGATGGCTGGCACAGAGTGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002348270 5:178563189-178563211 GCTGGAAGCCTGGCATCCAGAGG - Intronic
1003363963 6:5455077-5455099 GCACGATACCTGGCACAGAGCGG + Intronic
1003458512 6:6307142-6307164 GCACTATGCCTGGCACATAGTGG + Intronic
1003537019 6:6984378-6984400 GCACGATGCCAGGCACACAGAGG - Intergenic
1006626820 6:35403579-35403601 GCACGGTGCCTGGCATTTAGTGG - Intronic
1010734588 6:79429409-79429431 GAGGGATGCCTGGCAGAGAGAGG - Intergenic
1011418546 6:87148688-87148710 GTTCAATGCCTGGCACATAGTGG - Intergenic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1019308815 7:349008-349030 CCTCGATGCCTGGCCTTGTGAGG - Intergenic
1019433834 7:1011841-1011863 GGCAGATGCCTGGCACAGAGAGG + Intronic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1024243133 7:47450660-47450682 GCTAGAGGCCTGGCAGATAGTGG - Intronic
1025015494 7:55435829-55435851 GCACAATGCCTGGCACAGTGTGG - Intergenic
1026015157 7:66666503-66666525 GCTGGGAGCCTGGCACAGAGGGG - Intronic
1027889779 7:83957015-83957037 GCATGATGCCTGGCACAAAGAGG - Exonic
1027917595 7:84345899-84345921 TGTCGATGCCTGGCTTAGAAAGG - Intronic
1028979235 7:96948815-96948837 GCATAATGCCTGGCATAGAGTGG + Intergenic
1031046749 7:116898040-116898062 GCTCAATGCCTGGCTCATAGCGG - Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1036779429 8:11635278-11635300 GCTCCATGCCTGGCACATTGGGG + Intergenic
1037322702 8:17658998-17659020 TCTCGTTGCCTGGCACAGAATGG + Intronic
1037753987 8:21699852-21699874 GCACAGTGCCTGGCATGGAGTGG - Intronic
1037761012 8:21741586-21741608 GCATGGTGCCTGGCACAGAGTGG + Intronic
1038184106 8:25257248-25257270 GCTCGATGCCTGGCATAGAGAGG - Intronic
1038531251 8:28319551-28319573 GCTCACTGCCTGGCACAGAGTGG - Intronic
1044559305 8:93596845-93596867 GCTTGATGCCTGGCATATGGTGG - Intergenic
1045031265 8:98138691-98138713 GCACAATGTCTGGCACAGAGAGG + Intronic
1049759496 8:144325680-144325702 GCTGGATGACTGACAGAGAGGGG - Intronic
1051671918 9:19519174-19519196 AATCTATGCCTGGCATAGAGAGG - Intronic
1052262196 9:26530121-26530143 GCTCCCTACCTGGAATAGAGTGG - Intergenic
1054454590 9:65423364-65423386 GCACGATGCTTGGAACAGAGTGG - Intergenic
1059222966 9:112643280-112643302 GCCCAGTGCCTGGCACAGAGAGG + Intronic
1061541711 9:131280989-131281011 GCTGGATGACTGGGATATAGTGG + Intergenic
1061803991 9:133128117-133128139 GCTCGCTGCCTGGCACTGTGAGG + Intronic
1187247180 X:17563283-17563305 CCTCAATGCCTGGCACATAGGGG + Intronic
1187858380 X:23658583-23658605 GCTCTATGCGTGGCATGGACTGG - Intergenic
1188179041 X:27031210-27031232 GCACAATGCCTGGCATATAATGG - Intergenic
1188921157 X:35979264-35979286 GCTCCGTGCCTGGCCAAGAGTGG + Intronic
1190736655 X:53259912-53259934 GCACTGTGCCTGGCATACAGAGG - Intronic
1195036559 X:100975396-100975418 GAGCGATGCGTGGAATAGAGTGG - Intronic
1195112915 X:101665465-101665487 GCGACATGCTTGGCATAGAGGGG + Intergenic
1195323259 X:103738104-103738126 ACATGATGCCTGACATAGAGGGG - Intergenic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197916707 X:131543519-131543541 CCACGGTGCCTGACATAGAGTGG - Intergenic
1200215595 X:154366842-154366864 GCTCGATGCCTGGCAGGGGAAGG + Exonic