ID: 1038186084

View in Genome Browser
Species Human (GRCh38)
Location 8:25276204-25276226
Sequence CTTAAACTTAAGTGGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038186080_1038186084 2 Left 1038186080 8:25276179-25276201 CCAGCTCTGAGCCTTGGATGAAT 0: 1
1: 0
2: 2
3: 21
4: 182
Right 1038186084 8:25276204-25276226 CTTAAACTTAAGTGGATCCTGGG No data
1038186081_1038186084 -9 Left 1038186081 8:25276190-25276212 CCTTGGATGAATCACTTAAACTT 0: 1
1: 0
2: 15
3: 91
4: 568
Right 1038186084 8:25276204-25276226 CTTAAACTTAAGTGGATCCTGGG No data
1038186078_1038186084 12 Left 1038186078 8:25276169-25276191 CCTGCATTTACCAGCTCTGAGCC 0: 1
1: 0
2: 4
3: 21
4: 235
Right 1038186084 8:25276204-25276226 CTTAAACTTAAGTGGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038186084 Original CRISPR CTTAAACTTAAGTGGATCCT GGG Intronic
No off target data available for this crispr