ID: 1038189625

View in Genome Browser
Species Human (GRCh38)
Location 8:25308104-25308126
Sequence CACTATAAGCAACTGCACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038189625_1038189629 11 Left 1038189625 8:25308104-25308126 CCGATGTGCAGTTGCTTATAGTG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038189629 8:25308138-25308160 AGTAGAATGGAGGCTGTATTTGG No data
1038189625_1038189626 -2 Left 1038189625 8:25308104-25308126 CCGATGTGCAGTTGCTTATAGTG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038189626 8:25308125-25308147 TGCTTCTGCCTTCAGTAGAATGG No data
1038189625_1038189627 1 Left 1038189625 8:25308104-25308126 CCGATGTGCAGTTGCTTATAGTG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038189627 8:25308128-25308150 TTCTGCCTTCAGTAGAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038189625 Original CRISPR CACTATAAGCAACTGCACAT CGG (reversed) Intronic
906593407 1:47049710-47049732 CAATGTAAGCTACTGCTCATAGG + Intronic
909694982 1:78457201-78457223 CATTCTAAGCAATTGAACATGGG - Intronic
910983721 1:92983775-92983797 CACAAGAAGCAACTCCTCATTGG - Intergenic
923381292 1:233420708-233420730 TACTATAAGCAACTGTGTATAGG + Intergenic
1068936028 10:62636542-62636564 CCACATAAGCAACTGCACATTGG + Intronic
1069529868 10:69209341-69209363 CACTATAAGGAACTCTGCATGGG + Intergenic
1070679041 10:78435971-78435993 CTCTTTAAGCATCTGCACGTTGG + Intergenic
1076767891 10:132646549-132646571 CACTATTAGCAACAGCCTATAGG - Intronic
1085088449 11:73689333-73689355 CACTATTGTGAACTGCACATTGG - Intronic
1088327211 11:108613341-108613363 CACTAGAATCGACTGCACCTAGG - Intergenic
1090256131 11:125285936-125285958 CACATTCAGCAACTTCACATTGG + Intronic
1093869375 12:24269452-24269474 CAAAATAAGAAACTTCACATAGG - Intergenic
1094051312 12:26223578-26223600 CACCATAAGCAATAGCACAGAGG - Intronic
1099310425 12:81013862-81013884 CACTCTAAGCAAATTAACATAGG - Intronic
1100651147 12:96590279-96590301 CACCATTGGCAACTGCAAATAGG + Intronic
1101883997 12:108645895-108645917 CACTATAAGAAACTGGAAACGGG + Exonic
1106316295 13:28596841-28596863 CAAGATAAGCAACTGCAGAGTGG - Intergenic
1107312237 13:39091674-39091696 CTCAATAAACAACTTCACATAGG + Intergenic
1109706083 13:66094505-66094527 CACTGTACCCAACTGGACATAGG - Intergenic
1118381829 14:65223956-65223978 CAGTAAAAGCAACTGCAGGTTGG + Intergenic
1119595607 14:75930402-75930424 CACTCAAAGGAAATGCACATTGG + Intronic
1120013572 14:79444976-79444998 CACAATAAGCAACAGCATAAAGG + Intronic
1126807987 15:52372170-52372192 CGCTATAAGAAGCTGCACATCGG - Exonic
1127945476 15:63746831-63746853 CAATATATTCAACTGTACATTGG - Intronic
1134421938 16:14101270-14101292 CACTATAAGAAAAAGGACATAGG - Intronic
1137769840 16:51007299-51007321 TACTAGAAGCAGCAGCACATGGG - Intergenic
1137990352 16:53147820-53147842 CACCAAAAGCAACTGAAAATAGG - Intronic
1138300328 16:55920719-55920741 CATTAGAAGCAACTGCAAACAGG + Intronic
1143842022 17:9740019-9740041 CACTTTAAGCAAATGACCATAGG + Intergenic
1155471205 18:26194425-26194447 CACTATAAGCATCAGCACCATGG - Intergenic
1158914975 18:62115532-62115554 AAATATTGGCAACTGCACATGGG + Intronic
1159478295 18:68953260-68953282 AACTATAAAAAACTGTACATAGG - Intronic
928325995 2:30319977-30319999 CACAAGAAGCAACTGGAAATGGG - Intronic
929638845 2:43554957-43554979 CACTCAAAGGAAATGCACATTGG - Intronic
939997133 2:148930436-148930458 TATTATAAGAAACTGCACAGAGG + Intronic
942215426 2:173714685-173714707 CACCAGAAGCAACTCCACAGAGG + Intergenic
942287216 2:174431698-174431720 TACTTTAGGCCACTGCACATAGG - Intronic
945417670 2:209595081-209595103 TAAAATAAGCAATTGCACATTGG + Intronic
945770078 2:214032023-214032045 CACTATGAGCAACTGGAACTTGG - Intronic
947988816 2:234471208-234471230 CACTATAAGAAAGTGCTCCTTGG + Intergenic
948167689 2:235875665-235875687 CCCCATAAGCAAATGCAGATGGG - Intronic
1174993347 20:55538091-55538113 TAACATAAGTAACTGCACATAGG + Intergenic
1177057903 21:16332393-16332415 CACTATAATCTATTCCACATGGG + Intergenic
1177775273 21:25560430-25560452 AACTATAAGAAATTGCCCATAGG - Intergenic
949275177 3:2270842-2270864 CATACTAAACAACTGCACATCGG - Intronic
955757639 3:62241505-62241527 CATTATAAACAGCAGCACATGGG + Intronic
956387737 3:68738544-68738566 CAATGTAACCAACTGAACATAGG + Intronic
957884255 3:86263635-86263657 CACTAAAAGCATCTGGAAATTGG - Intergenic
959348923 3:105235804-105235826 CACACAAAGCAACTCCACATTGG + Intergenic
963683258 3:148408001-148408023 TACTATAAGCAACTGAAATTTGG + Intergenic
966888880 3:184391850-184391872 CCCTTCAGGCAACTGCACATTGG + Intronic
969207890 4:5661961-5661983 CACTATCTGCTATTGCACATAGG + Intronic
973254394 4:48094521-48094543 CACTGTAAGCAATTGGAGATGGG + Intronic
975420195 4:74155127-74155149 CAATAGAAGAAACTGCACATAGG - Intronic
978701914 4:111657274-111657296 CATTAAAAGCTTCTGCACATAGG - Intergenic
978887165 4:113777903-113777925 AACTATAAGCTACTGCTCAGAGG + Intergenic
981159874 4:141484881-141484903 CACTATAATTAACTGCAAAAAGG + Intergenic
984568655 4:181363157-181363179 AATTATCAGCAACTGAACATTGG + Intergenic
988412268 5:30901722-30901744 CACTATAAGCATATACAGATAGG + Intergenic
989497723 5:42128670-42128692 CACTTTTAGCAAGTGAACATGGG - Intergenic
990162396 5:52956648-52956670 CACTATCAGCAACTACGCCTGGG + Exonic
990549194 5:56855802-56855824 CAGTTAAAGCAACTGCACCTTGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
993784234 5:92108952-92108974 CACTACAAGCTACTTCACTTAGG - Intergenic
998649655 5:144103814-144103836 CACAATCAGAAACTGCACGTAGG - Intergenic
999969807 5:156847939-156847961 CACAATAAACAACAGCAAATAGG + Intergenic
1000695845 5:164382181-164382203 CACTCTAAGAAAATGCTCATTGG + Intergenic
1001971524 5:175958681-175958703 CATTACAAGCAAAGGCACATGGG + Intronic
1002245918 5:177885095-177885117 CATTACAAGCAAAGGCACATGGG - Intergenic
1013954596 6:115826358-115826380 GAATATAAGCAAGTGCACAAAGG + Intergenic
1017320650 6:153088717-153088739 CACCAAAAGCATCTGCACTTGGG - Intronic
1024729035 7:52234335-52234357 CCCCATAAGCACCTGCTCATAGG - Intergenic
1024768625 7:52691134-52691156 AAATATAAGAAAATGCACATTGG - Intergenic
1028344257 7:89760765-89760787 TACCATAGGCTACTGCACATGGG + Intergenic
1028914305 7:96241985-96242007 AAGTTTAAGCAACAGCACATAGG + Intronic
1038189625 8:25308104-25308126 CACTATAAGCAACTGCACATCGG - Intronic
1039730808 8:40274991-40275013 TACTATAAGCATCTGCACAAAGG + Intergenic
1043014723 8:74923669-74923691 AACCATAAGCAAGTGCACAGAGG + Intergenic
1043024279 8:75046676-75046698 CACAAAAAGTAACTACACATAGG + Intergenic
1043950145 8:86299571-86299593 CAAAATAATCAACTGCTCATGGG - Intronic
1050419460 9:5448278-5448300 CACTCTGAGAAACAGCACATTGG + Intergenic
1050699181 9:8318080-8318102 CACTATAAACAATTGGTCATTGG - Intronic
1052409004 9:28098683-28098705 TACTCTAAGCATCTCCACATGGG - Intronic
1058245593 9:102620833-102620855 CACTGTAAACATCTGCAAATAGG + Intergenic
1058494545 9:105542072-105542094 CACTATAAGCATTTACATATGGG + Intronic
1061758594 9:132833857-132833879 CGCAATTAGCAACTTCACATGGG + Intronic
1189799420 X:44678011-44678033 GAGTATAAGCCACTGCACCTGGG + Intergenic
1192733905 X:73830081-73830103 CACAATAAGAAAATTCACATAGG + Intergenic
1194853623 X:98900701-98900723 CATTATAGGCAACTGCACTATGG + Intergenic
1195620088 X:106944196-106944218 CACTATAAGAAACTACAGTTTGG - Intronic
1196714908 X:118801212-118801234 CACTAGAAGCAACAACACATCGG - Intergenic
1199790553 X:151151398-151151420 CACCATAAGCAACTGGAAGTTGG - Intergenic
1199941673 X:152633667-152633689 CACTATATGCAATTGCTCCTTGG - Intergenic
1201406672 Y:13657076-13657098 CACTAAAATCAACAGGACATGGG - Intergenic
1201857601 Y:18562396-18562418 AAAAATAAGCAACTGCACAGGGG - Intronic
1201875720 Y:18757985-18758007 AAAAATAAGCAACTGCACAGGGG + Intronic