ID: 1038191160

View in Genome Browser
Species Human (GRCh38)
Location 8:25322440-25322462
Sequence GAACTCAGTATGGCTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038191156_1038191160 19 Left 1038191156 8:25322398-25322420 CCAGTGAAGGGTGATGGGAGAAG 0: 1
1: 1
2: 2
3: 30
4: 274
Right 1038191160 8:25322440-25322462 GAACTCAGTATGGCTAAAGCAGG No data
1038191155_1038191160 20 Left 1038191155 8:25322397-25322419 CCCAGTGAAGGGTGATGGGAGAA 0: 1
1: 1
2: 2
3: 27
4: 278
Right 1038191160 8:25322440-25322462 GAACTCAGTATGGCTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038191160 Original CRISPR GAACTCAGTATGGCTAAAGC AGG Intronic
No off target data available for this crispr