ID: 1038191372

View in Genome Browser
Species Human (GRCh38)
Location 8:25324121-25324143
Sequence CACTCTCTCCAGAAAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038191372_1038191375 8 Left 1038191372 8:25324121-25324143 CCACCTGCTTTCTGGAGAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1038191375 8:25324152-25324174 TATTACTGAGTCTTCTAAGGAGG No data
1038191372_1038191374 5 Left 1038191372 8:25324121-25324143 CCACCTGCTTTCTGGAGAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1038191374 8:25324149-25324171 CATTATTACTGAGTCTTCTAAGG 0: 1
1: 0
2: 1
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038191372 Original CRISPR CACTCTCTCCAGAAAGCAGG TGG (reversed) Intronic
900372054 1:2336538-2336560 CAATCTTTCTAGAAGGCAGGCGG - Exonic
900567129 1:3339037-3339059 AACTCTCCCCAGACAGCAGCAGG - Intronic
900711379 1:4116726-4116748 CACTCTCCCCACAAAAAAGGGGG - Intergenic
901872046 1:12143845-12143867 CACTTCCTCCAGAGAGCACGTGG - Exonic
904813024 1:33176235-33176257 CTCTTTATACAGAAAGCAGGAGG + Intronic
905033455 1:34902667-34902689 CATTCTCTACAGAGAGCAGCAGG + Intronic
905935197 1:41817870-41817892 CCCTCTTTGAAGAAAGCAGGTGG + Intronic
906164918 1:43678992-43679014 CACTGTCACCAGAATGCAGATGG + Intronic
906673789 1:47678649-47678671 AACTGTGTTCAGAAAGCAGGGGG + Intergenic
907124365 1:52036309-52036331 AAATCTTTCCAGGAAGCAGGGGG + Intronic
907377532 1:54056220-54056242 GACTCTCTCCAGGAAAAAGGTGG + Intronic
909391324 1:75125300-75125322 AGCTCTGTTCAGAAAGCAGGTGG - Intergenic
912173828 1:107134092-107134114 CATTGTGACCAGAAAGCAGGTGG - Intergenic
912433657 1:109643521-109643543 GACTCTCCCCAGAAATCGGGCGG + Intergenic
912526241 1:110285273-110285295 CATTCTCTCCACAAAGCTGAAGG - Intergenic
913315313 1:117545503-117545525 CACTCTTTACATAAAGAAGGAGG - Intergenic
915030682 1:152878199-152878221 CAGACTCTCCAGCAGGCAGGGGG + Intergenic
915170239 1:153972644-153972666 AACACTCTCCAGAAGGCATGTGG + Intronic
915718101 1:157963365-157963387 CACTCTCTCCTGTAGGCAGGTGG - Intergenic
915955053 1:160214130-160214152 CAGTCTCTCCAGAGTACAGGTGG - Exonic
919418873 1:197346035-197346057 CACTGTTTCCAGAAAGCATCAGG + Intronic
919988991 1:202695956-202695978 CACTAACTCCAGAGAGCAGGAGG - Intronic
920196043 1:204228074-204228096 CCCTCTCACCAGACAGCATGCGG + Exonic
920987354 1:210902925-210902947 TACTTTCTCCTGAAGGCAGGAGG - Intronic
922930358 1:229384194-229384216 CACTCTAGCCAGAAGGAAGGAGG - Intergenic
923091241 1:230742967-230742989 CACTCCCTTCAGCAAGTAGGGGG + Intergenic
924850924 1:247829747-247829769 CACTCTCTGCACTAAGCTGGGGG + Intergenic
1064434059 10:15295414-15295436 CAGACTGTGCAGAAAGCAGGTGG - Intronic
1064576357 10:16749817-16749839 CACTCTCCCGAAAAGGCAGGCGG - Intronic
1064672815 10:17733303-17733325 CACCCTCTCTTTAAAGCAGGAGG - Intergenic
1067528953 10:47056394-47056416 CTCTCTCTCCAGGGAGGAGGTGG - Intergenic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1067758538 10:49025596-49025618 CCCCCTTTCCAGAAAGCTGGAGG - Intronic
1069666030 10:70159522-70159544 CAGTCTCTACAAAAAACAGGTGG + Intronic
1070947784 10:80407915-80407937 CACTCTTTCATGAAAGTAGGAGG - Intronic
1073544965 10:104339880-104339902 CACACCCTCCGCAAAGCAGGTGG + Intergenic
1074943426 10:118256999-118257021 CACTGTCACCAGTTAGCAGGAGG - Intergenic
1075072031 10:119326073-119326095 GACTCTCCACAGAAAGCAAGAGG + Intronic
1076370521 10:129949951-129949973 CCCTCTCAGCAGAAAGCAGTTGG - Intronic
1077057018 11:598746-598768 CAATCCTTCCAGAAAGCAGAGGG - Intronic
1077597849 11:3549499-3549521 GACTCTCTCCAAAAAGAAAGAGG - Intergenic
1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG + Intronic
1079083798 11:17431262-17431284 CCCCCTCTGCAGACAGCAGGCGG + Intronic
1084122466 11:67077625-67077647 CACCCTCTCCAGGAAGCTTGTGG + Intergenic
1084818946 11:71670515-71670537 GACTCTCTCCAAAAAGAAAGAGG + Intergenic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1089458035 11:118636781-118636803 CATTCCCTCCAGAAAGAAAGAGG - Intronic
1090036981 11:123257641-123257663 CATTCACTCCAGAAAGCACAGGG - Intergenic
1090354020 11:126127383-126127405 CAGTCTCTCCACAAAGCACTGGG - Intergenic
1091346420 11:134857208-134857230 CAACCTGGCCAGAAAGCAGGAGG + Intergenic
1091589699 12:1835946-1835968 CACCCTCTGGGGAAAGCAGGTGG + Exonic
1095823366 12:46505838-46505860 CACTTTATCCAGAAAGGATGGGG + Intergenic
1096598829 12:52714994-52715016 CACTCTCTACATCAATCAGGAGG - Intergenic
1096978844 12:55716921-55716943 CCCTCTCCCCAGAAAAGAGGAGG + Exonic
1097465896 12:59924094-59924116 CACTCCCTCCTGAGAGCAGAGGG + Intergenic
1099642013 12:85301945-85301967 CTCTCTCTCCAAAAAGCAGTGGG + Intergenic
1101304243 12:103511983-103512005 CACTCTCCCTAGAAGGCAGTTGG + Intergenic
1101865724 12:108518108-108518130 TTCTATGTCCAGAAAGCAGGAGG + Intronic
1107186498 13:37528210-37528232 CAATGTCCTCAGAAAGCAGGAGG + Intergenic
1108179546 13:47827245-47827267 CAGTATCTCCAACAAGCAGGAGG - Intergenic
1112991067 13:105514547-105514569 CGATCTCTGCAGAAAGCAGCTGG - Intergenic
1113542838 13:111122327-111122349 CTCTCTCTGCAGACACCAGGTGG - Intronic
1114835361 14:26197345-26197367 CACTCTCCCCAGAACGCAATGGG + Intergenic
1115878826 14:37892166-37892188 CACTAGCTCAGGAAAGCAGGTGG + Intronic
1117029927 14:51658007-51658029 CTCTCTCTCCAACAAGCATGTGG - Intronic
1118865992 14:69704024-69704046 CACACTTTCCTGCAAGCAGGTGG - Intronic
1121810381 14:96882631-96882653 AACATTCTACAGAAAGCAGGAGG - Intronic
1122669002 14:103355575-103355597 GACTTTCTCCAGAACCCAGGGGG + Intergenic
1202895940 14_GL000194v1_random:10352-10374 CCCTCTTTCCACAAAGCTGGAGG + Intergenic
1124022604 15:25938334-25938356 CTCTCACCCCAGAAGGCAGGAGG - Intergenic
1124631441 15:31339821-31339843 CACTCCCACGAGACAGCAGGCGG - Intronic
1124824342 15:33078784-33078806 CTCTCTCTCCAGGATGAAGGTGG - Intronic
1125214854 15:37259910-37259932 CACTCTCTTTAGAAAACAGCAGG + Intergenic
1125589176 15:40844047-40844069 CAGTTTCACCAGAAACCAGGGGG + Exonic
1126197878 15:45952187-45952209 CACCTTCCCCAGAAAGCAGTTGG + Intergenic
1126883337 15:53122947-53122969 CTCTCTCTCCTGAAAGCATTGGG + Intergenic
1127647125 15:60970019-60970041 CTCTCTCTCCAAAAAGAAGCGGG + Intronic
1128377293 15:67086273-67086295 CACTCTCTCACCAAAGCAGCAGG - Intronic
1128535778 15:68489142-68489164 CACTCTACCCACAAGGCAGGGGG + Intergenic
1129079535 15:73026780-73026802 CACACTGTCCTGAAAGCAGTGGG + Intergenic
1129804323 15:78442196-78442218 CACTCTATTAAAAAAGCAGGAGG - Intronic
1129895463 15:79102429-79102451 CACACTCTGCAGACAGAAGGCGG - Intergenic
1130972596 15:88745326-88745348 CACTCTCTCCAGAAATGTGGAGG - Intergenic
1131189627 15:90303481-90303503 CACTCTTTCAAGAAAGCAATTGG - Intronic
1132737386 16:1393699-1393721 CCCTCTCTCCACAAGGGAGGTGG + Intronic
1134677265 16:16099416-16099438 CACACACTGCAGAAGGCAGGAGG - Intronic
1135849337 16:25949018-25949040 CACTTGCTCCAAAAAGCAGTGGG - Intronic
1136579584 16:31143335-31143357 CACTCACTCCAGAAAGCAGCTGG + Exonic
1138167323 16:54815402-54815424 GACTCTCTCAAAAAAGCACGTGG - Intergenic
1138840977 16:60505675-60505697 CACTCTCGCTAGAAAGTAAGGGG - Intergenic
1139909797 16:70390666-70390688 CCCTCTGTCCAGACAGCAGCAGG - Intronic
1141362493 16:83409157-83409179 CAGTCTCTCATGAAAGCAGCTGG - Intronic
1141764324 16:86048544-86048566 CACTCTCTCTAGCTGGCAGGAGG + Intergenic
1143438751 17:6951489-6951511 CAATCTCTCCAGCAGGCAGTCGG - Intronic
1143627884 17:8121578-8121600 CAAGGTCTCCAGAAAGCGGGCGG + Exonic
1144385671 17:14747018-14747040 CCCTCCCTCCAGAAAGCAGAAGG - Intergenic
1145690473 17:26733394-26733416 CCCTGACTCCAGAATGCAGGTGG + Intergenic
1146912642 17:36658318-36658340 CACCCTCTCCTGAGAGAAGGTGG - Intergenic
1147361536 17:39933820-39933842 CCCTCCCTTCAGGAAGCAGGTGG - Intergenic
1147818677 17:43228704-43228726 CCCTCTCTCAACAAAGCAGGCGG - Intergenic
1147819096 17:43231296-43231318 CCCTCCCTCAACAAAGCAGGCGG + Intergenic
1147831960 17:43303406-43303428 CCCTCTCTCAACAAAGCAGGCGG - Intergenic
1147832379 17:43306001-43306023 CCCTCCCTCAACAAAGCAGGCGG + Intergenic
1148550728 17:48549527-48549549 CCCTCTCCACAGAAAGCAGTTGG - Exonic
1148832061 17:50440228-50440250 CACCCTCCCCAGGAAGCAGGGGG + Intronic
1153487468 18:5614468-5614490 GAGTCTCTCCGCAAAGCAGGAGG + Intronic
1153750922 18:8229441-8229463 TGCCCTCTCCAGAAAGCAGCAGG + Intronic
1153753855 18:8260713-8260735 CGATCTCTGCAGAGAGCAGGTGG - Intronic
1155439962 18:25851966-25851988 CACTCCCTCCACAAATCATGCGG - Intergenic
1158405020 18:57153165-57153187 CTAGCTCTCCAGAGAGCAGGAGG - Intergenic
1159013374 18:63080829-63080851 CAGTCTCTCCAGAAATCACTGGG + Intergenic
1159447904 18:68562835-68562857 CAGTCTCTACAGAAAGAATGAGG + Intergenic
1161039706 19:2103677-2103699 CACAGTCCCCAGAAGGCAGGGGG + Intronic
1163345192 19:16736799-16736821 CAGTTTGTCTAGAAAGCAGGGGG - Intronic
1164213242 19:23118561-23118583 TAGTCTCTCAAGAGAGCAGGTGG + Intronic
1165316722 19:35060497-35060519 CACTCACTCCGGGAAGCAGTGGG - Exonic
1165351764 19:35279573-35279595 CAGTACCTCCAGAGAGCAGGAGG - Exonic
1166359087 19:42244838-42244860 CGCTCCCTTCACAAAGCAGGTGG + Intronic
1168132365 19:54329742-54329764 GACTCTCTCCAGAGATTAGGAGG + Intergenic
925214720 2:2084588-2084610 CAGTCGCTGCAGAAACCAGGAGG + Intronic
927304361 2:21553736-21553758 CACTCTCTCTAGAAGTGAGGTGG + Intergenic
932982289 2:76684411-76684433 CAGTCTGTCCAGACAGGAGGAGG + Intergenic
933650947 2:84849848-84849870 CACTCTCGCCAGAAGGGATGTGG + Intronic
933988358 2:87613054-87613076 CAGGCTCACCAGGAAGCAGGAGG - Intergenic
934724901 2:96609859-96609881 AACTCTATCCAGAACTCAGGAGG + Intronic
936305483 2:111337754-111337776 CAGGCTCACCAGGAAGCAGGAGG + Intergenic
936699833 2:114998008-114998030 CACTGTCTCCACAAACCATGTGG + Intronic
938093244 2:128446909-128446931 CTCTGTCTCCAGAAAGCATCTGG - Intergenic
938751531 2:134335652-134335674 CACTATCTCAAGAAATAAGGTGG - Intronic
939610294 2:144301717-144301739 CATTTCCTCCAGAAAGCATGTGG - Intronic
942187555 2:173438638-173438660 CAATCCCTTTAGAAAGCAGGGGG + Intergenic
945043192 2:205759611-205759633 CTCTTTCTCCAGAAACCAGCCGG - Intronic
947073628 2:226318312-226318334 CACTTTATCTAGAATGCAGGAGG - Intergenic
948595992 2:239079587-239079609 CACCGTCCCCAGAAAGCATGTGG + Intronic
1169109482 20:3022668-3022690 CACTGTAGCCAGAGAGCAGGGGG - Exonic
1169704717 20:8489629-8489651 AACTGCCTCCAGAAATCAGGAGG + Intronic
1170507230 20:17039800-17039822 CACCCACTTCAGAAAGCAGATGG + Intergenic
1170788724 20:19490432-19490454 CCCTCTCTCCAGAAAGTCAGGGG - Intronic
1173803453 20:45909535-45909557 CTCTGTCTCCAGAATGCACGCGG - Exonic
1174872288 20:54194124-54194146 AAGTGTCTCCAGGAAGCAGGCGG - Intergenic
1174990524 20:55504318-55504340 CAGTCTCTCCAGCAATCAAGAGG - Intergenic
1175407791 20:58745944-58745966 GAGTCTCTGCAGAGAGCAGGAGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1176709545 21:10137400-10137422 CCCTCTTTCCACAAAGCTGGAGG - Intergenic
1176947879 21:15005746-15005768 CCCTCTCTCCAGAATGCTGGTGG - Intronic
1177410271 21:20721015-20721037 CCTTCTCTCCAGAAGTCAGGGGG - Intergenic
1177559230 21:22729268-22729290 GACTCTCTCAAGAAAGCCAGAGG + Intergenic
1178335253 21:31736880-31736902 TACTCTCTCCAGAAAGTATATGG - Intergenic
1178373354 21:32046325-32046347 CACGTTCTCCAGGAAGGAGGAGG + Intergenic
1179452672 21:41476263-41476285 CTCTTTCTCCAGAAAGCAAAGGG - Intronic
1180847683 22:18993176-18993198 CTCTCTCTCCACATACCAGGAGG + Intergenic
1180918957 22:19508680-19508702 CAGCCTCTCCAGGTAGCAGGAGG + Exonic
1182107326 22:27698687-27698709 GACCCTCTCCACACAGCAGGGGG - Intergenic
1185183664 22:49379458-49379480 CACACCCTCCAGGAAGCAAGTGG - Intergenic
1185303648 22:50099573-50099595 CACACTCTCCAGAGAGAAGTAGG - Exonic
1185333727 22:50262468-50262490 CACTCTCTCCAGCAGGGATGGGG + Intergenic
949163123 3:906049-906071 CACTATCACCAGAAAGGATGGGG + Intergenic
950197319 3:11018025-11018047 CGCTCTCTCCAGAGGGCAAGAGG - Intronic
950752607 3:15142378-15142400 GACTCTCTCCAAAAAGAAAGAGG + Intergenic
954690297 3:52392107-52392129 GAACCTCTCCACAAAGCAGGGGG + Intronic
954854790 3:53634954-53634976 CACTGTCTCAAGAAAGCTGAGGG + Intronic
955714343 3:61812939-61812961 AATTGTCTCCAGAAAGCAAGGGG - Intronic
956014931 3:64872586-64872608 CACTCCCTCCAGAAAAAAAGAGG + Intergenic
957419463 3:79950316-79950338 CAGTTTCTCCAGGTAGCAGGTGG - Intergenic
958863160 3:99468917-99468939 CTCACTTTTCAGAAAGCAGGTGG + Intergenic
959748461 3:109804991-109805013 CACTTTCTCAAGAAAATAGGAGG + Intergenic
962570612 3:136709728-136709750 CTCTCTCTAAAGAAAGAAGGTGG + Intronic
967330623 3:188285902-188285924 CACTACCTCCAGAAAGCAATGGG + Intronic
968120351 3:196121531-196121553 CCATCTCTCCAGCAGGCAGGAGG + Intergenic
968527967 4:1074114-1074136 CACTCTATCCAGCAACCACGAGG + Intronic
969710598 4:8840909-8840931 CCCTCTCTCCAGGAAGCACTGGG - Intergenic
971314418 4:25555307-25555329 AACTCTCTGCAGCAGGCAGGAGG - Intergenic
973167670 4:47097350-47097372 CACTTTCTCCAGAGAGCTGCAGG + Intronic
974471109 4:62319030-62319052 AACTTTCTTCAGAAAGCTGGTGG - Intergenic
975661131 4:76689749-76689771 GACGCGCTCCAGAAAGCAGCCGG - Intronic
976380485 4:84393100-84393122 CACTGCCTCCAGAGAGGAGGAGG + Intergenic
976705909 4:88018664-88018686 CACTCTCTCCAGCAAGCTCATGG + Intronic
977026958 4:91832190-91832212 CCCTTTCTCAAAAAAGCAGGGGG - Intergenic
977569338 4:98613302-98613324 CAATCTCTTCATAAAGCAGCAGG + Intronic
980100501 4:128536957-128536979 CTCTCTCTCAAGAAAGCATATGG - Intergenic
981804339 4:148696415-148696437 CACACTTTCCATAAAGAAGGAGG - Intergenic
982054641 4:151536023-151536045 CACTCTTTCCAGAAGGCATTTGG - Intronic
982590649 4:157304989-157305011 CACTCCCTTCTCAAAGCAGGGGG - Intronic
984298770 4:177888585-177888607 CCCACTCTCCAGAAAGCTGTTGG + Intronic
984389179 4:179106588-179106610 CACTCTCTCCAGAGAGTAAGTGG - Intergenic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
985717684 5:1471821-1471843 GACTCTGGCCAGAGAGCAGGAGG + Intronic
985717923 5:1473058-1473080 GACTCTGGCCAGAGAGCAGGAGG - Intronic
986170801 5:5312959-5312981 AAGTCTCTGCAGTAAGCAGGAGG - Intronic
986646402 5:9920787-9920809 CACTCTTTCCTCAAAGAAGGTGG + Intergenic
989301354 5:39897799-39897821 CACTCTCTTCTGAGAGCAGAAGG - Intergenic
990597343 5:57324814-57324836 CAGTCCACCCAGAAAGCAGGAGG + Intergenic
991136904 5:63193128-63193150 GACTCTTTGAAGAAAGCAGGAGG + Intergenic
992199834 5:74372105-74372127 CATTCCCATCAGAAAGCAGGGGG - Intergenic
993071569 5:83170808-83170830 CACTCACACCTGAAAGGAGGGGG + Intronic
993936374 5:94009309-94009331 CAGTCTTTGGAGAAAGCAGGTGG - Intronic
995453600 5:112329724-112329746 CACTCTCTACAGGAAAAAGGGGG + Intronic
996487870 5:124057913-124057935 GACTCCCTCCACAAAGCAGATGG + Intergenic
999146549 5:149399736-149399758 CACTGTCCTCAGAAACCAGGAGG - Intronic
1001334164 5:170783893-170783915 CCCTCTCTCCAGACACCTGGAGG - Intronic
1004008203 6:11656288-11656310 CACTCACATCTGAAAGCAGGCGG - Intergenic
1004144080 6:13048312-13048334 CATTTTCTCCAGACAGCATGAGG + Intronic
1004963724 6:20822759-20822781 CACTTTCTTCAGAAGGCAGCAGG - Intronic
1006479419 6:34279876-34279898 CATTCTCTCTAGATGGCAGGGGG + Exonic
1009469889 6:64019243-64019265 CACTCTCTCCAGAAGTCCTGAGG - Intronic
1011800091 6:91003085-91003107 AACACTCTCCATAAAGCATGAGG - Intergenic
1014737691 6:125113184-125113206 CACCCCCTCCAGAGAACAGGTGG - Intergenic
1015075621 6:129153120-129153142 CACTTTCTCCAGAAAGGATTGGG - Intronic
1015127492 6:129770791-129770813 CACTATCACGAGAAAGCATGGGG - Intergenic
1016991151 6:149929379-149929401 CACTTTCTCCAGCAACCAGGGGG + Intergenic
1019635973 7:2075932-2075954 GACTCTCCCCAGAAACCATGGGG + Intronic
1020051184 7:5082798-5082820 CACGCCTTCCAGGAAGCAGGGGG + Intergenic
1020622694 7:10536866-10536888 CACTGTCTACAGATATCAGGAGG + Intergenic
1020653852 7:10907250-10907272 CCCACACTCCAGAAAGCTGGGGG + Intergenic
1021777072 7:24064418-24064440 CAGTCTCTCCAAGCAGCAGGTGG - Intergenic
1022171551 7:27836703-27836725 CACCAGCCCCAGAAAGCAGGAGG + Intronic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1027418971 7:78001620-78001642 CATTCTCTTCAGTGAGCAGGTGG - Intergenic
1028235847 7:88360931-88360953 CACATTCTCCAGAAAGGAGATGG + Intergenic
1029747860 7:102526451-102526473 CCCTATCTCAAAAAAGCAGGTGG - Intergenic
1029765809 7:102625541-102625563 CCCTATCTCAAAAAAGCAGGTGG - Intronic
1030122368 7:106122495-106122517 CACTCTCTCTTGAAATCAGGTGG + Intergenic
1032170858 7:129583408-129583430 GACTTTCTCCAGACAGAAGGAGG + Intergenic
1032473013 7:132191935-132191957 CACCTTCTCCTGAAAGCATGAGG - Intronic
1035156509 7:156918577-156918599 CACACTTACCTGAAAGCAGGAGG - Intergenic
1035264185 7:157681509-157681531 GACCCTCTCCAGAAAACTGGAGG + Intronic
1035608699 8:946886-946908 CAGTCTGTGCATAAAGCAGGAGG + Intergenic
1035687825 8:1538631-1538653 CACTCGCAACAGAAAGCAAGCGG - Intronic
1036671526 8:10791714-10791736 GACTCTCTCTAGAAAGCCAGGGG - Intronic
1036795694 8:11754925-11754947 CAATCTCTCCACAAAGCCTGGGG - Intronic
1036996993 8:13669205-13669227 AACACTCTCCACAAAGCAGCAGG - Intergenic
1037155561 8:15694781-15694803 CACCCCCTCCAGTAATCAGGAGG - Intronic
1037987427 8:23298799-23298821 CCCCCACTCCAGGAAGCAGGCGG - Intronic
1038191372 8:25324121-25324143 CACTCTCTCCAGAAAGCAGGTGG - Intronic
1038262654 8:26010448-26010470 CACCTTCTCCACTAAGCAGGAGG - Intronic
1039662047 8:39478386-39478408 CATTCTCTGCAGAAAGGAAGAGG - Intergenic
1042224719 8:66506113-66506135 CACTCTCTCTAGAATACAGTAGG - Intronic
1042525244 8:69757880-69757902 CACTCTCTCCAGAAGACGGCAGG + Intronic
1043380904 8:79701019-79701041 CACTTTGTACAGCAAGCAGGTGG - Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1045193599 8:99907654-99907676 CTCTCTCTCTAGAAGGCAGAGGG - Intergenic
1049219101 8:141420777-141420799 GACTTTCTGCAGAAAGCAAGAGG + Intronic
1049242371 8:141544472-141544494 CACTCCCTCAAGAAAGGATGGGG + Intergenic
1049274926 8:141715488-141715510 CCCTCTCTGCACAAAGGAGGTGG - Intergenic
1049759359 8:144325129-144325151 CCCTCTCTCCAGGAGGCAGGGGG - Intronic
1053646518 9:40122936-40122958 CCCTCTTTCCACAAAGCTGGAGG - Intergenic
1053759196 9:41340615-41340637 CCCTCTTTCCACAAAGCTGGAGG + Intergenic
1054327529 9:63720838-63720860 CCCTCTTTCCACAAAGCTGGAGG - Intergenic
1054538052 9:66253037-66253059 CCCTCTTTCCACAAAGCTGGAGG + Intergenic
1055551308 9:77434456-77434478 CATGCTCTCCAGGGAGCAGGTGG - Exonic
1056589276 9:87952303-87952325 TACTCATTCCAGAAAGAAGGAGG - Intergenic
1056680561 9:88714157-88714179 CACTCTCTACAGACAGGAGAAGG + Intergenic
1057385649 9:94603831-94603853 CATTCTGTCCAGTATGCAGGTGG - Intronic
1057509744 9:95668084-95668106 TACTCTCTCCTGAAATCAGGTGG + Intergenic
1059602483 9:115795004-115795026 CATTATCTCCAGAATGCAGTGGG - Intergenic
1061532562 9:131226318-131226340 AACTCTCTCCTGATGGCAGGAGG - Intronic
1062288143 9:135782603-135782625 CCTCCTGTCCAGAAAGCAGGAGG + Intronic
1062331327 9:136046136-136046158 CAGCCCCTCCAGAGAGCAGGAGG - Intronic
1202794304 9_KI270719v1_random:106367-106389 CCCTCTTTCCACAAAGCTGGAGG - Intergenic
1186383943 X:9090615-9090637 AACCCTGTCCAGGAAGCAGGAGG - Intronic
1188485141 X:30674311-30674333 AACTTTCTCCATGAAGCAGGAGG - Intronic
1189232259 X:39461685-39461707 CACAAACTCCTGAAAGCAGGAGG - Intergenic
1189386922 X:40544772-40544794 CACACCCCCCAGAAAGCACGGGG + Intergenic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1190756382 X:53405386-53405408 CACTGTCTACACACAGCAGGGGG + Exonic
1190950821 X:55141056-55141078 CACCTTCTCCACAAAGCAGCAGG - Intronic
1193006229 X:76621302-76621324 CACTCTCTCAAGAATGAAGTAGG + Intergenic
1194540850 X:95170573-95170595 GTCCCTCTGCAGAAAGCAGGAGG - Intergenic
1195091402 X:101463133-101463155 CACTCTCTGGAGAGAGGAGGTGG + Intronic
1195314742 X:103666439-103666461 CACTGTCTCCTAAGAGCAGGGGG - Intergenic
1195328487 X:103777219-103777241 CACTCTCTCCAGAGATCTGTGGG - Intronic
1196345026 X:114644963-114644985 CATTCTCTATAAAAAGCAGGTGG + Intronic
1199717141 X:150514999-150515021 CTCTCTCAGCAGGAAGCAGGAGG - Intergenic