ID: 1038191372

View in Genome Browser
Species Human (GRCh38)
Location 8:25324121-25324143
Sequence CACTCTCTCCAGAAAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038191372_1038191374 5 Left 1038191372 8:25324121-25324143 CCACCTGCTTTCTGGAGAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1038191374 8:25324149-25324171 CATTATTACTGAGTCTTCTAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
1038191372_1038191375 8 Left 1038191372 8:25324121-25324143 CCACCTGCTTTCTGGAGAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1038191375 8:25324152-25324174 TATTACTGAGTCTTCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038191372 Original CRISPR CACTCTCTCCAGAAAGCAGG TGG (reversed) Intronic