ID: 1038191747

View in Genome Browser
Species Human (GRCh38)
Location 8:25328078-25328100
Sequence GCATTCTGGTCTTCTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038191743_1038191747 4 Left 1038191743 8:25328051-25328073 CCGCTAGTTGCCCTAGTCGCATT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG No data
1038191745_1038191747 -7 Left 1038191745 8:25328062-25328084 CCTAGTCGCATTTCAAGCATTCT 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG No data
1038191744_1038191747 -6 Left 1038191744 8:25328061-25328083 CCCTAGTCGCATTTCAAGCATTC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038191747 Original CRISPR GCATTCTGGTCTTCTGCAGC TGG Intronic
No off target data available for this crispr