ID: 1038196082

View in Genome Browser
Species Human (GRCh38)
Location 8:25369494-25369516
Sequence GTTGGCCATGTCTTCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 649}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038196081_1038196082 -10 Left 1038196081 8:25369481-25369503 CCAAGTCTAGAAAGTTGGCCATG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1038196082 8:25369494-25369516 GTTGGCCATGTCTTCTTCTAAGG 0: 1
1: 0
2: 0
3: 23
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038196082 Original CRISPR GTTGGCCATGTCTTCTTCTA AGG Intronic
904025355 1:27499438-27499460 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
904162560 1:28532318-28532340 GATGGCCGTGTCTTCCTCTGGGG + Exonic
906856684 1:49313963-49313985 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
906856815 1:49315289-49315311 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
906881994 1:49601748-49601770 GTTGCCTACGTTTTCTTCTAAGG - Intronic
906908397 1:49920134-49920156 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
907562966 1:55407969-55407991 GTTGGCCATCTCTTTTCTTAGGG - Intergenic
907684492 1:56596830-56596852 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
907857958 1:58322135-58322157 ATTGCCTATGTTTTCTTCTAGGG - Intronic
908583497 1:65543564-65543586 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
908600916 1:65738963-65738985 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
909049726 1:70753298-70753320 CCTGGCCATGACTTCTTATAGGG - Intergenic
909456654 1:75857383-75857405 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
909671318 1:78191777-78191799 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
909805366 1:79868209-79868231 GTTGTCCAGGTTTTCTGCTAGGG + Intergenic
910177653 1:84448114-84448136 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
910452968 1:87365692-87365714 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
910600747 1:89029618-89029640 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
910605288 1:89076872-89076894 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
911923109 1:103792521-103792543 GGTGGACATGTCTTCTTACAAGG + Intergenic
912099504 1:106188714-106188736 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
913472253 1:119200863-119200885 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
916599507 1:166278052-166278074 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
917009289 1:170452843-170452865 GTTGCCAAGGTTTTCTTCTAGGG + Intergenic
917413211 1:174781662-174781684 ATTGGCTAGGTTTTCTTCTATGG + Intronic
917997336 1:180454420-180454442 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
918108988 1:181439388-181439410 GTAGGCCATGACTTTGTCTATGG + Intronic
918805268 1:189032528-189032550 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
918821522 1:189261609-189261631 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
919077312 1:192829443-192829465 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
919215029 1:194542144-194542166 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
919573066 1:199272449-199272471 ACAGGCCATGTCTTCTTCTTAGG + Intergenic
920993738 1:210966279-210966301 ATTGCCTATGTTTTCTTCTAGGG - Intronic
921559731 1:216642810-216642832 CTTGGCAATGTCTTCTTCAGAGG + Intronic
921831076 1:219728359-219728381 ATTGCCCAGGTTTTCTTCTAAGG + Intronic
921841327 1:219831653-219831675 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
922069454 1:222176879-222176901 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
922666984 1:227478922-227478944 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
923287600 1:232511771-232511793 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
923875942 1:238047245-238047267 GTTGTCTAGGTTTTCTTCTAGGG + Intergenic
923974894 1:239251364-239251386 GTTGGCCCTGTTTACATCTAGGG - Intergenic
924407967 1:243772084-243772106 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
924411652 1:243812067-243812089 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
924430604 1:243993523-243993545 GATGGCCGTGTCTTGTTCCACGG + Intergenic
924828571 1:247568270-247568292 ATTGCCCAAGTTTTCTTCTAGGG + Intronic
1062916768 10:1246433-1246455 GATGCCCAGGTTTTCTTCTAGGG + Intronic
1062918485 10:1261198-1261220 GATGCCCAGGTTTTCTTCTAGGG - Intronic
1064530830 10:16308015-16308037 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1064933473 10:20653368-20653390 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1065554459 10:26901347-26901369 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1066599490 10:37089377-37089399 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1066751941 10:38666908-38666930 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1067198221 10:44141711-44141733 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1067893639 10:50156716-50156738 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1067955208 10:50783550-50783572 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1068505522 10:57894978-57895000 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1069120337 10:64562249-64562271 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1069353270 10:67554850-67554872 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1070651101 10:78236945-78236967 GTCTCCCATGTCATCTTCTATGG - Intergenic
1071743984 10:88394087-88394109 ATTGCCTATGTTTTCTTCTAGGG - Intronic
1071938321 10:90556308-90556330 TTTTGCCATTTCTCCTTCTATGG - Intergenic
1072281411 10:93869086-93869108 CTGGGCCATATCTTCATCTATGG - Intergenic
1072383571 10:94900208-94900230 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1072744776 10:97932436-97932458 GTTGTCCATCTCTCCTACTAGGG - Intronic
1072876643 10:99180156-99180178 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1074476053 10:113775463-113775485 CTTTTCCATGCCTTCTTCTATGG + Intronic
1074648037 10:115486833-115486855 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1076043796 10:127274514-127274536 GATGGCCATGTCTTTGGCTAAGG + Intronic
1077953453 11:6987889-6987911 TTTGGCCATTTCTTCTTCTTAGG + Intergenic
1078036842 11:7814646-7814668 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1078039245 11:7843085-7843107 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1078119756 11:8494990-8495012 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
1078120114 11:8498977-8498999 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
1078122117 11:8521521-8521543 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
1078293094 11:10035309-10035331 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
1078321271 11:10337145-10337167 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1079232765 11:18663805-18663827 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1079708126 11:23647366-23647388 ATTGCCTAAGTCTTCTTCTAGGG + Intergenic
1079825871 11:25191973-25191995 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1079864641 11:25719846-25719868 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1079868329 11:25763337-25763359 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1080468677 11:32524178-32524200 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1080786761 11:35482131-35482153 GTTGCCTATGTTTTCTTCTAGGG + Intronic
1082127361 11:48448905-48448927 TTTGCCTATGTTTTCTTCTAGGG + Intergenic
1082292148 11:50388895-50388917 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1082560929 11:54619836-54619858 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1082743766 11:56940156-56940178 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1082755179 11:57067808-57067830 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1082867003 11:57909368-57909390 ATTGGCTAAGTTTTCTTCTAGGG + Intergenic
1082967741 11:58985037-58985059 ATTGGCTATGTTTTCTTCTAAGG + Intronic
1083003220 11:59316567-59316589 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1084687647 11:70706378-70706400 GTTGGCCACGTCATCTCCTTGGG + Intronic
1084835683 11:71800476-71800498 GTTGGCCCTGATTTCTTCTTTGG - Exonic
1085135457 11:74083337-74083359 ATTGCCTATGTTTTCTTCTAGGG - Intronic
1086008721 11:82072251-82072273 GTTGGCCATCTCCTCCTGTATGG - Intergenic
1086555756 11:88109416-88109438 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1086569083 11:88262623-88262645 TTTGGCCATGACTACTGCTAAGG - Intergenic
1086758106 11:90591398-90591420 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1087888243 11:103505498-103505520 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1087950428 11:104214148-104214170 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1088077851 11:105874012-105874034 ATTGCCTAGGTCTTCTTCTAGGG + Intronic
1088404739 11:109461587-109461609 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
1088594856 11:111433449-111433471 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1088856913 11:113763955-113763977 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1089244891 11:117111525-117111547 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1089248748 11:117142335-117142357 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1089383877 11:118055531-118055553 GTGGGGCATGTCTTCTCCTGGGG + Intergenic
1090677223 11:129010388-129010410 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1091417599 12:302566-302588 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1092925533 12:13268798-13268820 GATGGCCATGTCACCTTCTCCGG + Intergenic
1094453599 12:30607458-30607480 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1094876097 12:34644553-34644575 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1095032986 12:37318972-37318994 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1095813771 12:46399241-46399263 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1096877145 12:54638529-54638551 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1096938234 12:55308069-55308091 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1097129314 12:56798758-56798780 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1097321176 12:58228035-58228057 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1097375342 12:58836482-58836504 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1097412549 12:59272956-59272978 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1097893707 12:64803594-64803616 ATTGGCTAGGTTTTCTTCTATGG + Intronic
1098515271 12:71368433-71368455 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1098785473 12:74748715-74748737 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1099239670 12:80124133-80124155 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1100054917 12:90497451-90497473 CTTGGCCATTCCTGCTTCTAGGG - Intergenic
1100087447 12:90929076-90929098 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1101070689 12:101072485-101072507 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1101231294 12:102744196-102744218 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1101448223 12:104753664-104753686 GGTGGCCATGTATTCTTTTCTGG - Intronic
1101596309 12:106168488-106168510 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1102328917 12:112013062-112013084 GTAGGCCTTGTCATCTTCGAAGG + Exonic
1102679460 12:114681478-114681500 CTTGCCCATGTCTTTTTCTGTGG + Intronic
1102729992 12:115100180-115100202 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1104586204 12:130049888-130049910 GTTTGCCATGTCTTGTCCTAAGG + Intergenic
1105875534 13:24549517-24549539 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1106638792 13:31560773-31560795 GTTGCCTAGGTTTTCTTCTAAGG + Intergenic
1106767695 13:32931433-32931455 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1107300095 13:38957251-38957273 GTATGCCATGTCTTGTTCTCTGG - Intergenic
1107318465 13:39160021-39160043 GTTGGCCTTGTCTTCTTGACAGG - Intergenic
1107370807 13:39745136-39745158 ATTGGCTAAGTTTTCTTCTAGGG - Intronic
1107472964 13:40707828-40707850 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1107648619 13:42521326-42521348 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1107775349 13:43834354-43834376 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1107915442 13:45145391-45145413 GTTGGCCATGGTTCCTTTTAGGG + Intronic
1108005513 13:45942111-45942133 GCTGGCCATTTCTTCTTCTCAGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108737266 13:53297273-53297295 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1108840076 13:54602358-54602380 GTTGTCTAGGTTTTCTTCTAGGG - Intergenic
1109087880 13:57999527-57999549 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1109161660 13:58982929-58982951 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1109870685 13:68328421-68328443 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1110349359 13:74489185-74489207 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1110530773 13:76595113-76595135 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1110631478 13:77713105-77713127 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1111092642 13:83466844-83466866 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1111148525 13:84216930-84216952 GTAGGCCATTGCTTTTTCTAAGG - Intergenic
1111286699 13:86103114-86103136 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1111346266 13:86958477-86958499 ATTGCCCAGGTTTTCTTCTAAGG - Intergenic
1111747238 13:92285786-92285808 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1113409922 13:110076202-110076224 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1114335831 14:21688932-21688954 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1114346891 14:21805934-21805956 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
1115048179 14:29023899-29023921 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1115294206 14:31807718-31807740 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1115414246 14:33112762-33112784 ATTGCCTATGTTTTCTTCTAGGG + Intronic
1115842330 14:37485927-37485949 ATTGCCCAAGTTTTCTTCTAGGG + Intronic
1115893397 14:38057864-38057886 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1115939844 14:38596537-38596559 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1116036566 14:39634635-39634657 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1116590399 14:46764367-46764389 GTTGCCTAGGTATTCTTCTAGGG - Intergenic
1116634900 14:47382249-47382271 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1119476628 14:74934294-74934316 GGTGGGCATGTTTTATTCTAGGG + Intergenic
1120247551 14:82024953-82024975 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1121213549 14:92228529-92228551 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1121372024 14:93367842-93367864 GTAGTCCATGATTTCTTCTATGG + Intronic
1122367869 14:101205928-101205950 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1122391271 14:101387191-101387213 ATTGTCCATGTTTTCTTCTAGGG + Intergenic
1202920361 14_KI270723v1_random:25605-25627 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1126108188 15:45160775-45160797 GCTGGCCCTGTATTCTGCTATGG + Intronic
1127863052 15:63010441-63010463 GTTGGCCATGTCATTTTGCAGGG - Intergenic
1128675513 15:69605543-69605565 GATGCCCATGTCTTCTCTTAGGG + Intergenic
1129127245 15:73453028-73453050 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
1130039111 15:80389747-80389769 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1131577657 15:93607839-93607861 GTTTGCCATGTATTATTCTTAGG + Intergenic
1133348349 16:5085052-5085074 GTTGGCCTTGATTTCTTCTCTGG + Exonic
1135783746 16:25329183-25329205 GAAGGCCAGGTCTTATTCTAAGG + Intergenic
1137064399 16:35824823-35824845 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1137824577 16:51480348-51480370 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1137907513 16:52338438-52338460 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1137973760 16:53012529-53012551 TTTGACCATGACTTCTTCTGTGG - Intergenic
1138518530 16:57555191-57555213 GTTGTTCATGTCTTCTGATATGG + Intronic
1138810836 16:60148584-60148606 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1139061119 16:63252995-63253017 ATTTGCCATGTCTTCTACTTAGG + Intergenic
1140147869 16:72329430-72329452 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1140474094 16:75229961-75229983 GTTGGCCAGGTCGTGGTCTATGG + Exonic
1140883856 16:79225407-79225429 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1141017914 16:80467560-80467582 GTAGGTCATTTCTTCTTATAAGG - Intergenic
1143147653 17:4787003-4787025 TTTGTATATGTCTTCTTCTAAGG - Intergenic
1143458870 17:7087227-7087249 GTTTACCATTTTTTCTTCTATGG + Intergenic
1145198583 17:20918546-20918568 ATTGACCAGGTTTTCTTCTAGGG + Intergenic
1146636426 17:34509318-34509340 GGTGGTCTTGTGTTCTTCTATGG - Intergenic
1149071576 17:52550074-52550096 GTTGCCTAAGTTTTCTTCTAGGG + Intergenic
1149270762 17:54975007-54975029 GGTGGCCATGTCTTCTGGAAAGG + Intronic
1149359193 17:55875431-55875453 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1149901500 17:60483825-60483847 ATTGCCCAGGTTTTCTTCTACGG + Intronic
1150044838 17:61902305-61902327 GTTGGTAATGTTTTCTTCTTGGG + Intronic
1150629306 17:66867566-66867588 ATTGGCTATATTTTCTTCTAGGG + Intronic
1151126281 17:71848238-71848260 GATGGCTATGTCTTCTTATTGGG - Intergenic
1151588603 17:75027986-75028008 ATAGACCATATCTTCTTCTAAGG - Intergenic
1153529303 18:6028132-6028154 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1153669994 18:7402332-7402354 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
1153974595 18:10257199-10257221 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1154065709 18:11105092-11105114 CTTGGCTATGTTTTCTTCTGTGG - Intronic
1154320219 18:13344178-13344200 ATTGCCTAGGTCTTCTTCTAGGG + Intronic
1154511175 18:15104178-15104200 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1156064157 18:33119083-33119105 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1156919241 18:42500310-42500332 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1156923188 18:42547796-42547818 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1157749982 18:50169505-50169527 TTGGGCCATGTCTTTTTCTCTGG - Intronic
1157814043 18:50718130-50718152 GTTAGCCATTTCTTCTTCTCTGG - Intronic
1157944878 18:51968004-51968026 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1158274801 18:55755825-55755847 GTTGGCGTTGTCTTCCTCTAAGG - Intergenic
1158297207 18:56011659-56011681 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1158812328 18:61051988-61052010 AATGCCCATGTTTTCTTCTAGGG - Intergenic
1159581783 18:70241476-70241498 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1161036394 19:2087355-2087377 GCTGGCCAGGGCTTCTTTTAGGG - Intronic
1163810851 19:19430491-19430513 GTTGGCCATGTCATGTTCCCAGG + Intronic
1164151917 19:22561451-22561473 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1164555866 19:29250736-29250758 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1165814860 19:38635426-38635448 GTTGGCCATCTTTTATTCTTGGG + Intronic
1166021894 19:40039007-40039029 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1166180588 19:41105088-41105110 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1167470522 19:49673218-49673240 GTGGGCCAGGTCCTCTGCTAGGG + Intronic
925303368 2:2832680-2832702 GTTGGCCGTGGGTTCTTCCAGGG - Intergenic
925438946 2:3867428-3867450 CTGTGCAATGTCTTCTTCTAAGG - Intergenic
925861680 2:8183596-8183618 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
926874976 2:17465882-17465904 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
926876797 2:17489527-17489549 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
927567978 2:24130888-24130910 ATTGCCTATGTTTTCTTCTAGGG + Intronic
928634898 2:33234945-33234967 ATTGCCTATGTTTTCTTCTAGGG - Intronic
929019930 2:37542411-37542433 GTTTGGCATGTCTTTTTCTTCGG + Intergenic
929035889 2:37691288-37691310 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
929062446 2:37936989-37937011 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
929358551 2:41055409-41055431 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
930143612 2:47978746-47978768 GTTGCCTAGGTTTTCTTCTAAGG - Intergenic
930383621 2:50663082-50663104 CTTGGACATGTTTTCTTCTCTGG - Intronic
930478514 2:51916317-51916339 GTTGCCTATGTTTTCTTCTAAGG - Intergenic
930987367 2:57606827-57606849 ATTGACTATGTGTTCTTCTAGGG - Intergenic
931065937 2:58587159-58587181 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
931132321 2:59350472-59350494 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
931160761 2:59687904-59687926 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
931478679 2:62617505-62617527 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
931556500 2:63511793-63511815 ATTGCCTATGTTTTCTTCTAGGG - Intronic
931974152 2:67624408-67624430 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
932347135 2:71002943-71002965 GTTGGACATGTCTTTTGCCAGGG + Intergenic
932670417 2:73733166-73733188 GTTGGTTATGTCTTGTTCAAAGG + Intronic
933126956 2:78620779-78620801 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
933506949 2:83189042-83189064 GGTGCCCGTGTCTTCATCTAGGG + Intergenic
934750231 2:96789245-96789267 GTTAGCCATGTTGTCTTTTAGGG - Intronic
935472007 2:103471777-103471799 ATTGGCTAGGTCTTCTTCTAGGG + Intergenic
936762205 2:115800531-115800553 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
936945631 2:117928156-117928178 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
937645371 2:124260412-124260434 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
937645682 2:124263744-124263766 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
937806739 2:126153665-126153687 ATTGCCTATGTCGTCTTCTAAGG + Intergenic
937893493 2:126958707-126958729 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
939132853 2:138258440-138258462 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
939796177 2:146646891-146646913 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
939837402 2:147147755-147147777 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
941073090 2:160976667-160976689 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
941214096 2:162684244-162684266 ATTGCCTATGTTTTCTTCTAGGG - Intronic
941502101 2:166291966-166291988 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
942111801 2:172689895-172689917 ATTGTCCAGGTTTTCTTCTAGGG - Intergenic
943093658 2:183403407-183403429 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
943163453 2:184284592-184284614 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
943303856 2:186235345-186235367 ATTGGCTAGGTGTTCTTCTAGGG - Intergenic
943305187 2:186252729-186252751 ATTGGCTAGGTGTTCTTCTAGGG - Intergenic
943351168 2:186798013-186798035 GTTGCCTAAGTTTTCTTCTAGGG - Intergenic
943660817 2:190557370-190557392 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
944254343 2:197609713-197609735 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
944630291 2:201617603-201617625 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
945369241 2:208996067-208996089 ATTGCCCATGTTTTCTTCTAGGG - Intergenic
945927876 2:215824360-215824382 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
946054626 2:216889844-216889866 GATGGGCATGTCTTCCTATATGG + Intergenic
946106887 2:217378591-217378613 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
946781696 2:223197975-223197997 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
946794502 2:223335551-223335573 ATTGCCCAGGTTTTCTTCTAAGG - Intergenic
948191453 2:236062349-236062371 TCTGGCCATGGCTTCCTCTAGGG - Intronic
1169497454 20:6129017-6129039 CTTGGCCATGTCTTTTGCTTTGG + Intergenic
1171408059 20:24926788-24926810 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1173055656 20:39609968-39609990 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1177008023 21:15698053-15698075 ATTGTCTATGTTTTCTTCTAGGG - Intergenic
1177351262 21:19944987-19945009 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1177384904 21:20396277-20396299 TTTGTCTATGTCTACTTCTAAGG + Intergenic
1177524372 21:22272917-22272939 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1177620695 21:23588997-23589019 ATTGCCTATGTATTCTTCTAAGG + Intergenic
1178372720 21:32039734-32039756 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1179428304 21:41300085-41300107 GTTGCCTATGTTTTCTTCTAGGG - Intergenic
1182204985 22:28614839-28614861 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1185423786 22:50751239-50751261 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
949611185 3:5705315-5705337 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
949631720 3:5935481-5935503 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
949800056 3:7893923-7893945 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
951687147 3:25357607-25357629 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
952440632 3:33324398-33324420 ATTGCCTAGGTCTTCTTCTAGGG + Intronic
952676931 3:36043889-36043911 ATTGCCCATCTATTCTTCTAAGG + Intergenic
952724416 3:36568428-36568450 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
952753032 3:36840777-36840799 GCTGGGCATGTCTGCTTCTGGGG - Intronic
952837250 3:37614060-37614082 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
953375974 3:42428862-42428884 GTTGAGCATGTCTTCTACTGAGG + Intergenic
954126554 3:48534312-48534334 GTTGGCCATCATTTCTTCAAAGG - Intronic
954490980 3:50904857-50904879 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
954785734 3:53090992-53091014 GTTTGCCTTGTCTTATTCTGAGG + Exonic
955762778 3:62305935-62305957 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
956025768 3:64981631-64981653 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
956053159 3:65270594-65270616 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
956132574 3:66068315-66068337 TTAGCCCGTGTCTTCTTCTATGG + Intergenic
956215835 3:66847826-66847848 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
956243877 3:67159314-67159336 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
957052695 3:75422298-75422320 GTTGGCCCTGATTTCTTCTTTGG + Intergenic
957116229 3:76030462-76030484 ATTGCCCAGGTTTTCTTCTATGG + Intronic
957390932 3:79567985-79568007 GTGGCCCATGACTTCTTCTACGG + Intronic
959644355 3:108680995-108681017 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
959801441 3:110500077-110500099 GTTGCCTAAGTTTTCTTCTAGGG - Intergenic
960930007 3:122837606-122837628 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
961095758 3:124155154-124155176 AATGGCCAGGTTTTCTTCTAGGG - Intronic
961363540 3:126383947-126383969 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
961419204 3:126786920-126786942 ATTGCCTATGTTTTCTTCTAGGG + Intronic
961886308 3:130098522-130098544 GTTGGCCCTGATTTCTTCTTTGG + Intronic
964262418 3:154854268-154854290 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
964648620 3:158986686-158986708 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
964844808 3:161033737-161033759 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
964966827 3:162504541-162504563 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
965523086 3:169688333-169688355 GTTGGTCATGTGTTTTTCCATGG - Intergenic
965999109 3:174925166-174925188 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
966758943 3:183398076-183398098 GTTAGCCATCTCTGCTTCAATGG - Intronic
967077683 3:186018952-186018974 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
969106995 4:4814598-4814620 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
969758492 4:9166117-9166139 GTTGGCCCTGATTTCTTCTTTGG - Intergenic
969818453 4:9703554-9703576 GTTGGCCCTGATTTCTTCTCTGG - Intergenic
970288360 4:14543935-14543957 ATTGTCCAGGTTTTCTTCTAAGG - Intergenic
970623884 4:17856211-17856233 GCTGACCATTTCTTCTGCTATGG + Intronic
970895974 4:21104690-21104712 ATTGCCTATGTTTTCTTCTAGGG + Intronic
971429602 4:26551652-26551674 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
971517937 4:27512170-27512192 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
971521731 4:27561089-27561111 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
972196624 4:36661078-36661100 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
972208208 4:36803598-36803620 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
972227422 4:37029427-37029449 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
972248716 4:37275994-37276016 ATTGCCTATGTTTTCTTCTAGGG - Intronic
972357620 4:38295559-38295581 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
972539989 4:40030896-40030918 GTTAGCCAGGTCTTCTGCTCAGG + Intergenic
972884609 4:43470412-43470434 ATAGACCATGTCTTTTTCTAAGG - Intergenic
972919100 4:43916096-43916118 GTTGCCTAAGTTTTCTTCTAGGG - Intergenic
972953517 4:44359258-44359280 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
972984916 4:44751523-44751545 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
973075197 4:45916424-45916446 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
973129392 4:46631613-46631635 ATTGGCTAGATCTTCTTCTAGGG + Intergenic
973585103 4:52382670-52382692 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
974102003 4:57427451-57427473 GTTGGACAGGTCTTCATGTAAGG - Intergenic
974113856 4:57556835-57556857 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
974119376 4:57620430-57620452 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
974164025 4:58177404-58177426 GTTGGCAATATGTTCTTTTATGG + Intergenic
974654768 4:64804511-64804533 ATTGCCCAAGTTTTCTTCTAAGG - Intergenic
975083472 4:70308525-70308547 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
975755578 4:77568344-77568366 GTTGGCCAGGTGTGCTGCTATGG - Intronic
975765142 4:77659730-77659752 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
975843569 4:78501817-78501839 ATTGCCTAGGTCTTCTTCTAGGG + Intronic
975867145 4:78735807-78735829 GATAGCTATTTCTTCTTCTAGGG + Intergenic
976099465 4:81545424-81545446 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
976448667 4:85161743-85161765 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
976594771 4:86884797-86884819 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
976862041 4:89676986-89677008 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
977102045 4:92829110-92829132 GTTGTCTAGGTTTTCTTCTAGGG + Intronic
977106340 4:92890161-92890183 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
977467274 4:97398421-97398443 ATTGCCTAGGTCTTCTTCTAGGG + Intronic
977632482 4:99258551-99258573 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
977653628 4:99497154-99497176 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
977914070 4:102571378-102571400 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
977994904 4:103489785-103489807 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
978004389 4:103598549-103598571 ATTGCCTATGTTTTCTTCTAGGG + Intronic
978004981 4:103604435-103604457 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
978133052 4:105222811-105222833 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
978185558 4:105853204-105853226 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
978204856 4:106069240-106069262 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
978272008 4:106902390-106902412 ATTGCCCAAGTTTTCTTCTAGGG - Intergenic
978672832 4:111271767-111271789 GTTCTCCATGTCTTCATTTAAGG + Intergenic
979177393 4:117681247-117681269 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
979310958 4:119202701-119202723 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
979389269 4:120108307-120108329 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
979391009 4:120127822-120127844 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
979875276 4:125882325-125882347 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
980037366 4:127900647-127900669 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
980419746 4:132544521-132544543 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
980477038 4:133331452-133331474 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
981443855 4:144812061-144812083 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
981750357 4:148087760-148087782 GCTGGCTAGGTTTTCTTCTAGGG - Intronic
981882829 4:149636232-149636254 GGTGGCCATCTCTTCCTCTTTGG - Intergenic
982047238 4:151460991-151461013 GTATGCCATCTATTCTTCTAGGG + Intronic
982295767 4:153827261-153827283 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
982394066 4:154897021-154897043 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
982569512 4:157030805-157030827 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
982680948 4:158429273-158429295 GTTGACCATTTCTTATTTTAAGG - Intronic
982810539 4:159820435-159820457 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
983602142 4:169543083-169543105 TTTGGCTAGGTTTTCTTCTAGGG + Intronic
983893398 4:173055578-173055600 GTTGGCCATCTCATTTTTTACGG - Intergenic
984319287 4:178170966-178170988 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
984643766 4:182198903-182198925 TTTGACTTTGTCTTCTTCTATGG - Intronic
985075757 4:186212709-186212731 GTAGGACATGTGTTCTTCAATGG + Intronic
985468741 5:23337-23359 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
985473339 5:61200-61222 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
987469012 5:18307861-18307883 GTTGACCCTGTCTTCTGCTACGG - Intergenic
987695011 5:21316858-21316880 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
987760392 5:22154842-22154864 TTTGGCCAAGTCCTCTTCTCAGG + Intronic
988397194 5:30709952-30709974 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
988603404 5:32659972-32659994 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
988610362 5:32717951-32717973 ATTGCCTAAGTCTTCTTCTAGGG + Intronic
989464901 5:41743575-41743597 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
989493409 5:42083188-42083210 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
989672190 5:43931867-43931889 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
989778691 5:45238944-45238966 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
989785088 5:45317459-45317481 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
990028658 5:51227578-51227600 ATTGGCAACATCTTCTTCTAGGG + Intergenic
990370541 5:55114143-55114165 GTTGGCTATGTCTTCTCCATGGG - Exonic
991165377 5:63561144-63561166 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
991167281 5:63578789-63578811 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
991225443 5:64265322-64265344 ATTGTCTATGTTTTCTTCTATGG + Intronic
991274665 5:64830473-64830495 GTTGTCTAGGTTTTCTTCTAGGG - Intronic
991745215 5:69732582-69732604 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
991752491 5:69822640-69822662 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
991796783 5:70312311-70312333 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
991802109 5:70379376-70379398 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
991824593 5:70607896-70607918 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
991831810 5:70697769-70697791 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
991889162 5:71311868-71311890 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
991895167 5:71388285-71388307 TTTGGCCAAGTCCTCTTCTCAGG + Intergenic
991976457 5:72188031-72188053 TTTGGCTGTGTCTTCTTCCAAGG + Intronic
993444545 5:87995175-87995197 GTTGTCTAGGTTTTCTTCTAGGG - Intergenic
993789774 5:92194565-92194587 GATGCCTATGTTTTCTTCTAGGG + Intergenic
994233245 5:97333491-97333513 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
994288297 5:97996350-97996372 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
994315890 5:98332564-98332586 GTTGTCTAGGTTTTCTTCTAAGG + Intergenic
994466795 5:100145127-100145149 GTGAGCCATGTCTACTTCTGGGG - Intergenic
994517029 5:100785072-100785094 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
994526903 5:100917111-100917133 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
994534187 5:101007164-101007186 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
994576756 5:101588353-101588375 ATTGCCTATGTTTTCTTCTATGG - Intergenic
994865142 5:105259026-105259048 GTTGGCCATATCTTTCTCCACGG - Intergenic
995427182 5:112038428-112038450 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
995467088 5:112461840-112461862 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
995489392 5:112674589-112674611 GTTGGCTAGGTTTTCTTCTAGGG + Intergenic
996598494 5:125232787-125232809 CATGGCCATTTCTTGTTCTATGG + Intergenic
996668700 5:126090997-126091019 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
996676140 5:126176880-126176902 GTTGCCTAAGTTTTCTTCTAGGG - Intergenic
997071005 5:130622071-130622093 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
998332110 5:141338381-141338403 GTTAGCTACGTTTTCTTCTAAGG - Intronic
998541512 5:142986600-142986622 ATTGGCTAGGTTTTCTTCTAGGG + Intronic
998542409 5:142995060-142995082 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
999049442 5:148506418-148506440 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
999897309 5:156048920-156048942 GTTGCCTAGGTTTTCTTCTAAGG + Intronic
1001355429 5:171017849-171017871 GTTGGTTAGGTTTTCTTCTAGGG + Intronic
1002360406 5:178665890-178665912 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1003576902 6:7305667-7305689 GTTGTCCTTGTTCTCTTCTAAGG - Intronic
1005555882 6:26982981-26983003 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1006198623 6:32265215-32265237 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1006222876 6:32509172-32509194 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1006246459 6:32741243-32741265 GATGTCCCTGTCTTCTTCCAGGG + Intergenic
1007824055 6:44585257-44585279 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1008269686 6:49476468-49476490 ATTGCCTATGTTTTCTTCTAGGG - Intronic
1008303569 6:49872496-49872518 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1008613866 6:53207688-53207710 GATGGCCATGTCTTCCTCTGAGG - Intergenic
1009510597 6:64546416-64546438 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1009634658 6:66249893-66249915 ATTGCCCATGTTTTTTTCTAGGG - Intergenic
1010226064 6:73490385-73490407 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1010351876 6:74884377-74884399 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1010583601 6:77629459-77629481 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1010684656 6:78839152-78839174 GTTGCCTAGGTTTTCTTCTATGG - Intergenic
1011297843 6:85842647-85842669 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1011303765 6:85904126-85904148 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1011339770 6:86301149-86301171 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1011386551 6:86804341-86804363 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1011407828 6:87034327-87034349 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1011418202 6:87144646-87144668 TTTGCCTATGTTTTCTTCTAGGG - Intergenic
1011432947 6:87307270-87307292 ATTGCCTATGTTTTCTTCTAGGG - Intronic
1011833425 6:91402020-91402042 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1012204298 6:96441649-96441671 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1012725402 6:102804504-102804526 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1012778465 6:103526933-103526955 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1012921986 6:105229640-105229662 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1013462018 6:110383822-110383844 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1013882663 6:114924294-114924316 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1013964665 6:115940374-115940396 GTTGCCTAGGTTTTCTTCTAGGG - Exonic
1014150493 6:118049259-118049281 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1014427437 6:121325669-121325691 ATTGCCCAAGTTTTCTTCTAGGG - Intronic
1014498088 6:122152599-122152621 GATGGCCATTTCTTCTTAAATGG - Intergenic
1014548748 6:122763434-122763456 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1014979668 6:127931229-127931251 GTTGCCTAGGTATTCTTCTAGGG - Intergenic
1015273860 6:131364755-131364777 GCTGAGCATGTGTTCTTCTATGG - Intergenic
1015386265 6:132627541-132627563 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1015738473 6:136427167-136427189 GCTGTCCTTGGCTTCTTCTAGGG - Intronic
1017287998 6:152700703-152700725 ATTTGCCATGTCCTCCTCTAAGG + Intronic
1017338078 6:153285142-153285164 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1017974589 6:159345677-159345699 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1018113585 6:160560876-160560898 ATTGCCTATGTTTTCTTCTAGGG + Intronic
1019110922 6:169713201-169713223 GTTGGAGAAGTCTTCATCTAGGG - Intronic
1020649930 7:10861695-10861717 GTAGGCCATGTGTTCTTATTAGG - Intergenic
1020659064 7:10961174-10961196 ATTGCCCATGTTTTCTTCTAAGG + Intergenic
1020675542 7:11179646-11179668 TTTGGCCATTTCTTCTTTTGAGG + Intergenic
1021768451 7:23972599-23972621 GTTGGACATGTGTTCTTCACTGG - Intergenic
1022422377 7:30235978-30236000 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1022848005 7:34230646-34230668 GTTGCCCAGGTTTTCTTCTAGGG + Intergenic
1022885356 7:34637900-34637922 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1023464927 7:40443818-40443840 ATTGCCTATGTTTTCTTCTAGGG + Intronic
1023723235 7:43116307-43116329 TTGGGCCATGTTTCCTTCTAAGG - Intronic
1023926040 7:44670493-44670515 GCTGGCCATGTCTTCTTGAATGG + Intronic
1024206310 7:47164703-47164725 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1024367797 7:48542616-48542638 GTTGACCATATTTCCTTCTAAGG - Intronic
1024375877 7:48637331-48637353 GCTTGCCATGGCTTCTTCTATGG + Intronic
1024885404 7:54136510-54136532 ATTGCCCAGGTTTTCTTCTATGG + Intergenic
1024915923 7:54499826-54499848 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1025067560 7:55870643-55870665 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1025869677 7:65419777-65419799 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
1025874273 7:65465587-65465609 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1027330293 7:77085609-77085631 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1028521365 7:91734799-91734821 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1028632471 7:92950040-92950062 GTTGGCCCTCTCTTCTTGGAAGG - Intergenic
1028950731 7:96631599-96631621 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1029785465 7:102785725-102785747 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
1029913319 7:104178656-104178678 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1030287478 7:107841212-107841234 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1030403822 7:109085679-109085701 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1030426511 7:109385554-109385576 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1030534493 7:110748794-110748816 ATTGGCTAGGTTTTCTTCTAGGG - Intronic
1030549112 7:110936094-110936116 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1030566914 7:111169180-111169202 GTTGGGAATGTCTTTTTCTTTGG - Intronic
1031172944 7:118314380-118314402 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1031307791 7:120154787-120154809 ATTGCCTAGGTCTTCTTCTAGGG + Intergenic
1031530884 7:122874927-122874949 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1031830351 7:126618422-126618444 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1031878392 7:127167905-127167927 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1031953266 7:127914353-127914375 GCTGGCCATGCCTTCTTCCCTGG + Intronic
1032603237 7:133322313-133322335 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1032872287 7:135999182-135999204 TTTGGCATTTTCTTCTTCTATGG - Intergenic
1033787980 7:144757091-144757113 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1035237970 7:157511960-157511982 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1035558347 8:584872-584894 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1035711722 8:1721984-1722006 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1036848024 8:12182874-12182896 GTTGGCCCTGATTTCTTCTTTGG + Exonic
1036869387 8:12425157-12425179 GTTGGCCCTGATTTCTTCTTTGG + Intergenic
1038059160 8:23892964-23892986 GTTTGCCATATCCTTTTCTAAGG - Intergenic
1038196082 8:25369494-25369516 GTTGGCCATGTCTTCTTCTAAGG + Intronic
1038623293 8:29165814-29165836 GTTGGCCACTTCTTTTTCCAGGG - Intronic
1039572833 8:38601039-38601061 GTTGGCCATGTCTTCATCAGTGG - Intergenic
1040707690 8:50149487-50149509 ATTGGCTAGGTTTTCTTCTAGGG + Intronic
1040784631 8:51150918-51150940 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1041459217 8:58093345-58093367 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1041471290 8:58212158-58212180 GTTGGCTATGGCTGCTCCTAGGG + Intergenic
1041600036 8:59706084-59706106 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1041916265 8:63142370-63142392 ATTGCCCAAGTTTTCTTCTAGGG + Intergenic
1041942303 8:63402227-63402249 GTTGCCCATTTCATGTTCTATGG + Intergenic
1042265798 8:66908165-66908187 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1042308270 8:67354031-67354053 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1042331195 8:67582404-67582426 GTTGGCCAGGACTTATACTATGG - Intronic
1042634148 8:70854618-70854640 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1043223418 8:77694813-77694835 ATTGGCTATGTTTTCTTCTATGG + Intergenic
1043643339 8:82485200-82485222 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1043774100 8:84242935-84242957 GTTGTCTAAGTTTTCTTCTAGGG + Intronic
1043785110 8:84388938-84388960 GTTGCCTAGGTTTTCTTCTAGGG + Intronic
1044314761 8:90737080-90737102 GTTGCCTAAGTCGTCTTCTAGGG - Intronic
1044594714 8:93947719-93947741 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1044610323 8:94085378-94085400 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1045867503 8:106884776-106884798 ATTGCCCAAGTTTTCTTCTAGGG - Intergenic
1045953077 8:107873786-107873808 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1046247398 8:111582369-111582391 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1047083916 8:121495367-121495389 GTTGGCCATTTCTTCTCTGAGGG + Intergenic
1047631150 8:126710015-126710037 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1047928694 8:129704955-129704977 GTGAGACATGGCTTCTTCTAAGG + Intergenic
1048397588 8:134029160-134029182 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1048587241 8:135785948-135785970 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1050011615 9:1190906-1190928 ATTGCCAATGTTTTCTTCTAGGG + Intergenic
1050034678 9:1422999-1423021 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1050071651 9:1821210-1821232 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1050217224 9:3340298-3340320 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1050632526 9:7575499-7575521 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1050866555 9:10507844-10507866 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1050979373 9:11989899-11989921 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1051536887 9:18169221-18169243 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1051537989 9:18181181-18181203 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1051914330 9:22190011-22190033 GTTGTCTACGTTTTCTTCTAGGG - Intergenic
1052326953 9:27225632-27225654 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1052327463 9:27230977-27230999 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1052579748 9:30340130-30340152 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1055870470 9:80872121-80872143 GTTGGCCCATTCTTCTTCTTTGG + Intergenic
1057290589 9:93803936-93803958 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1057370700 9:94470280-94470302 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1058225868 9:102362725-102362747 GGTGACCATGTCTTCCTCTGGGG - Intergenic
1058233506 9:102461064-102461086 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1058558597 9:106199437-106199459 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1059123619 9:111663147-111663169 GGAGGCCAGGTTTTCTTCTAAGG + Intronic
1060244971 9:121937691-121937713 GTTTGCCTGGTCTTTTTCTAGGG - Intronic
1060747692 9:126148576-126148598 ATTGTCCATGTCTGCTTCTAGGG + Intergenic
1061979669 9:134094379-134094401 CTTCCCCCTGTCTTCTTCTAGGG - Intergenic
1187074477 X:15920604-15920626 GATAGCAATGTCTTCCTCTAAGG + Intergenic
1187624414 X:21094339-21094361 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1187627646 X:21133931-21133953 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1188155071 X:26731710-26731732 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1188845708 X:35069323-35069345 TTTGGCTAGGTTTTCTTCTAGGG - Intergenic
1188983609 X:36750360-36750382 GTTGGCCACGTTTTCTCCTTAGG + Intergenic
1190464793 X:50715545-50715567 ATTTGCCATGTCTTCTTTTGAGG - Intronic
1190494313 X:51013751-51013773 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1190552125 X:51595097-51595119 GTTGTCTAGGTTTTCTTCTAGGG + Intergenic
1190584780 X:51928436-51928458 GTTGCCTAAGTTTTCTTCTAGGG + Intergenic
1190998014 X:55630671-55630693 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1191124382 X:56938991-56939013 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1191125537 X:56949833-56949855 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1191127411 X:56972546-56972568 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1191158399 X:57300504-57300526 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1191193227 X:57689296-57689318 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1191582698 X:62782345-62782367 GTTGTCTAGGTTTTCTTCTAGGG + Intergenic
1191635539 X:63372083-63372105 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1191886045 X:65889103-65889125 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1192001069 X:67152017-67152039 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1192058541 X:67798999-67799021 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1192063359 X:67854391-67854413 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1192283601 X:69710092-69710114 ATTGCCTAGGTCTTCTTCTAGGG + Intronic
1192525419 X:71839023-71839045 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1192666634 X:73095029-73095051 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1192684181 X:73286389-73286411 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1192685512 X:73300724-73300746 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1192686361 X:73309836-73309858 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1193031231 X:76900343-76900365 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1193169571 X:78320205-78320227 ATTGCCTATGTTTTCTTCTAGGG + Intronic
1193183883 X:78489477-78489499 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1193303313 X:79919370-79919392 ATTGGCTAGGTTTTCTTCTAGGG - Intergenic
1193413993 X:81199773-81199795 ATTGCCTAGGTCTTCTTCTAGGG - Intronic
1193434400 X:81454279-81454301 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1193514807 X:82450440-82450462 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1193712894 X:84899961-84899983 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1193771078 X:85588184-85588206 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1193845345 X:86463570-86463592 ATTGCCCAGGTTTTCTTCTAGGG - Intronic
1193922273 X:87444216-87444238 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1194133347 X:90109016-90109038 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1194396401 X:93392587-93392609 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1194636090 X:96346460-96346482 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1194780984 X:98025369-98025391 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1194949692 X:100110484-100110506 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1195133023 X:101873452-101873474 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1195148262 X:102040247-102040269 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1195456349 X:105074137-105074159 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1195957224 X:110344389-110344411 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1195986045 X:110631352-110631374 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1195988788 X:110661932-110661954 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1195993500 X:110707689-110707711 GTTGCCTAGGTTTTCTTCTAGGG - Intronic
1196490193 X:116256402-116256424 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1196560687 X:117144459-117144481 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1196587679 X:117448466-117448488 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1196597902 X:117566216-117566238 ATTGGCTAGGTTTTCTTCTAGGG + Intergenic
1197045972 X:121999134-121999156 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1197320032 X:125017109-125017131 ATTGCCTATGTTTTCTTCTAGGG - Intergenic
1199796665 X:151204881-151204903 GTTGCCTAGGTTTTCTTCTAGGG - Intergenic
1199937259 X:152586935-152586957 ATTGCCTAGGTCTTCTTCTAGGG - Intergenic
1200388025 X:155913468-155913490 ATTGCCCAGGTTTTCTTCTAGGG + Intronic
1200479127 Y:3679108-3679130 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1200760548 Y:7034861-7034883 ATTGCCCAAGTTTTCTTCTAGGG - Intronic
1201591551 Y:15620584-15620606 ATTGCCCAGGTTTTCTTCTAGGG - Intergenic
1201681965 Y:16656035-16656057 GTTGCCTAGGTTTTCTTCTAGGG + Intergenic
1201734257 Y:17240553-17240575 ATTGCCCAGGTTTTCTTCTAGGG + Intergenic
1202034291 Y:20615956-20615978 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1202052287 Y:20793697-20793719 ATTGCCTATGTTTTCTTCTAGGG + Intergenic
1202175090 Y:22091098-22091120 ATTGTCTATGTTTTCTTCTAGGG - Intronic
1202216272 Y:22495285-22495307 ATTGTCTATGTTTTCTTCTAGGG + Intronic
1202326914 Y:23700779-23700801 ATTGTCTATGTTTTCTTCTAGGG - Intergenic
1202543855 Y:25969273-25969295 ATTGTCTATGTTTTCTTCTAGGG + Intergenic