ID: 1038197176

View in Genome Browser
Species Human (GRCh38)
Location 8:25378997-25379019
Sequence GGGGTGTACCAACAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038197163_1038197176 29 Left 1038197163 8:25378945-25378967 CCACCTGAGCTGCAAAACCAGCA 0: 66
1: 149
2: 243
3: 302
4: 460
Right 1038197176 8:25378997-25379019 GGGGTGTACCAACAGGGAGCAGG No data
1038197162_1038197176 30 Left 1038197162 8:25378944-25378966 CCCACCTGAGCTGCAAAACCAGC 0: 44
1: 67
2: 92
3: 76
4: 281
Right 1038197176 8:25378997-25379019 GGGGTGTACCAACAGGGAGCAGG No data
1038197164_1038197176 26 Left 1038197164 8:25378948-25378970 CCTGAGCTGCAAAACCAGCAACT 0: 2
1: 86
2: 209
3: 345
4: 538
Right 1038197176 8:25378997-25379019 GGGGTGTACCAACAGGGAGCAGG No data
1038197166_1038197176 12 Left 1038197166 8:25378962-25378984 CCAGCAACTTTTTGTTAAGGATT 0: 1
1: 1
2: 55
3: 541
4: 994
Right 1038197176 8:25378997-25379019 GGGGTGTACCAACAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038197176 Original CRISPR GGGGTGTACCAACAGGGAGC AGG Intronic
No off target data available for this crispr