ID: 1038199772

View in Genome Browser
Species Human (GRCh38)
Location 8:25401171-25401193
Sequence TGGCATGGAAATAGTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038199768_1038199772 3 Left 1038199768 8:25401145-25401167 CCAAGTGAGTTGTAATAACTTAG 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1038199772 8:25401171-25401193 TGGCATGGAAATAGTGAGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038199772 Original CRISPR TGGCATGGAAATAGTGAGGC TGG Intronic
901875441 1:12164732-12164754 TGGGATGGAGATGGTCAGGCTGG - Intergenic
903300143 1:22372973-22372995 TGGAATGGAAAAAGGGAGGGAGG + Intergenic
904930918 1:34086885-34086907 TGGAAGGGAAAAAGTGAGGCTGG - Intronic
905697961 1:39989750-39989772 TGACATGTAAATTTTGAGGCTGG - Intergenic
906874774 1:49525564-49525586 GGGCATGGAAATAAAGAGGAGGG + Intronic
909666008 1:78134436-78134458 TGGCATGGGAATGGGGAGGGAGG - Intronic
911689578 1:100817498-100817520 TGGCATGGATATAGTTAGCAGGG + Intergenic
912120278 1:106462789-106462811 TAGCATGGAAATAGTATGGAAGG + Intergenic
912513793 1:110205772-110205794 ATGCATGGAATTAATGAGGCGGG - Intergenic
914831380 1:151173419-151173441 TGACATGGGACTAGTGAGGAAGG - Intronic
917886015 1:179385751-179385773 TGGGAAGGAATAAGTGAGGCAGG + Intronic
919937448 1:202264064-202264086 GGGCCAGGAAATAGGGAGGCTGG + Intronic
920109242 1:203575474-203575496 TGGCATGGGCAGAGTGAGGGTGG - Intergenic
920610964 1:207437563-207437585 TGGCATGGTGAAAGTGAGACAGG + Intergenic
1063906835 10:10788864-10788886 TGGCATGGAAAGATTGGAGCTGG + Intergenic
1064593892 10:16923428-16923450 TGGCATGGAAATAGATATGGTGG + Intronic
1064677078 10:17771350-17771372 TGCTATGGAAAAGGTGAGGCAGG - Exonic
1066510515 10:36090468-36090490 TAGGATGGTATTAGTGAGGCTGG - Intergenic
1066750244 10:38647935-38647957 TGGCATAGAAATAGAGAAGTAGG + Intergenic
1066943818 10:41897673-41897695 TGGAATGGAATCAATGAGGCTGG + Intergenic
1068834529 10:61539340-61539362 AGTGATGGAAATAGTGAGGCAGG + Intergenic
1069045685 10:63741023-63741045 TGTCATGGCAATAGTGAGTTCGG - Intergenic
1071013022 10:80961273-80961295 TGGGATGGAAAAAGTAGGGCAGG + Intergenic
1071474123 10:86010520-86010542 TGGAAAGGAAGTAATGAGGCCGG + Intronic
1072651391 10:97298511-97298533 TGGCAGGGAAAAAGGGAGGGAGG + Intergenic
1072680712 10:97504242-97504264 TGGGATGGAAATAGTCTGTCGGG - Intronic
1074951395 10:118340733-118340755 TGGCATACAAACAGTGTGGCAGG + Intronic
1075785887 10:125049808-125049830 TGGCATGGAACTTGGAAGGCTGG - Intronic
1077439497 11:2561457-2561479 GGGCATGGGAATAGTGTAGCAGG - Intronic
1081451726 11:43177327-43177349 TAGGATGGAAAAAGGGAGGCAGG - Intergenic
1081802263 11:45868080-45868102 AGGCATGGAGAGGGTGAGGCTGG + Intronic
1083882266 11:65554429-65554451 TGGCAAGGAAGTAGGGAGGAGGG - Intronic
1086072003 11:82810243-82810265 TGGCTTGGAAACTGTGAAGCTGG + Intergenic
1087607302 11:100392450-100392472 TGAAATGGAAATAATAAGGCAGG - Intergenic
1088102376 11:106169461-106169483 TGACATAGAAGTAGTCAGGCTGG - Intergenic
1090418482 11:126557208-126557230 TGGCAGGGAAAGAGTCGGGCAGG - Intronic
1091027645 11:132156259-132156281 TAGAATGAAAATAGTGAGGCAGG - Intronic
1092321408 12:7480220-7480242 TTGGATGGAAGAAGTGAGGCAGG + Intronic
1092524079 12:9298899-9298921 TGGTCTGGAGAGAGTGAGGCAGG + Intergenic
1092543192 12:9432915-9432937 TGGTCTGGAGAGAGTGAGGCAGG - Intergenic
1094509827 12:31089522-31089544 TGGTCTGGAGAGAGTGAGGCAGG + Intronic
1095427807 12:42096125-42096147 TGGCATGGAATTAGAGAATCAGG + Intronic
1097559859 12:61189571-61189593 TGACATGGAGATAGTGAAGTTGG - Intergenic
1100684863 12:96976529-96976551 TTCCATGGAAATAGAGAGGTTGG + Intergenic
1101261564 12:103037132-103037154 TAGCATGCAAAGACTGAGGCTGG - Intergenic
1101585441 12:106081639-106081661 GTGCAGGGAAACAGTGAGGCAGG - Intronic
1102052256 12:109871379-109871401 TAGAATGGAAATATTGGGGCCGG - Intronic
1102235105 12:111289563-111289585 TGTCCTGGAAGAAGTGAGGCAGG + Intronic
1106924577 13:34600614-34600636 TGTCATGGAAGGAGTGAGACAGG + Intergenic
1108288557 13:48933675-48933697 TGGCATGGATGTAGTGAAGAGGG - Intergenic
1108894758 13:55311899-55311921 TGGCATGGAAATGATGTGTCTGG + Intergenic
1110475492 13:75908476-75908498 AGGAATTGAAATAATGAGGCCGG - Intergenic
1110733923 13:78912503-78912525 TGGGAAGGAAATAGACAGGCAGG - Intergenic
1110745997 13:79054015-79054037 TGGTAGGGAAATAGAGAGGAAGG - Intergenic
1111596164 13:90414256-90414278 TTGCATAGAAATAGGGAGGGAGG - Intergenic
1112199540 13:97261623-97261645 TGGCAGGGAAAGAGAAAGGCAGG - Intronic
1112490407 13:99858024-99858046 GTGCATGGAAAGGGTGAGGCTGG - Intronic
1114881206 14:26788419-26788441 TGTCCTGGAAATAGTGAGTGAGG + Intergenic
1116774655 14:49166074-49166096 TGGTCTGGAAAAAGGGAGGCAGG - Intergenic
1120400366 14:84023153-84023175 GGGCATGGTAAGAGTGAGACCGG - Intergenic
1121307856 14:92918106-92918128 TGGCTGGGAGAGAGTGAGGCCGG - Intergenic
1121578397 14:95007417-95007439 TGGGATGGGAATAGGGAGGCAGG + Intergenic
1202929957 14_KI270725v1_random:27635-27657 GGGCAGGGAAATAGCGTGGCCGG - Intergenic
1124720582 15:32108101-32108123 TGGCATGGAAGCATTGAGGGAGG - Intronic
1125591072 15:40854737-40854759 CTGGATGGAAATAGTGAGGATGG - Intronic
1126366341 15:47898535-47898557 TGTCATGGACACACTGAGGCTGG - Intergenic
1127089948 15:55457216-55457238 TGGCATGGCCAGAGTGAGACTGG + Intronic
1127625577 15:60776836-60776858 GGGCAAGGAAAAAGGGAGGCAGG - Intronic
1127627085 15:60790192-60790214 TGCCATGGAATAAGTGAGTCAGG - Intronic
1131218263 15:90558490-90558512 TGGCATGGAGTGAGTGAGGAGGG - Intronic
1132218215 15:100083775-100083797 TGACTTGGGAATAGTGATGCTGG + Intronic
1133637541 16:7683150-7683172 TGGCTCTGAAATAGTGAGGAAGG + Intronic
1134073016 16:11272333-11272355 TGGGATGGAAGGAGTGAGGGAGG + Intronic
1134659395 16:15972409-15972431 TGGCATTGGATTAGTGATGCAGG + Intronic
1135964293 16:27023056-27023078 GGGCATGGATAAAGAGAGGCAGG - Intergenic
1136382361 16:29901451-29901473 TGGGATGGGTAGAGTGAGGCGGG + Exonic
1136732467 16:32429147-32429169 TGGCATAGAAATAGAGAAGTAGG - Intergenic
1136773360 16:32859157-32859179 GGGCAGGGAAATAGTATGGCCGG - Intergenic
1136897254 16:34002362-34002384 GGGCAGGGAAATAGTATGGCCGG + Intergenic
1137581142 16:49634344-49634366 TTGAATGAAAATAGCGAGGCCGG - Intronic
1138053176 16:53804244-53804266 TAGCATTCAAACAGTGAGGCAGG - Intronic
1138129254 16:54465503-54465525 TATCATGAAGATAGTGAGGCAGG - Intergenic
1138329353 16:56201045-56201067 TGTCATGGAAGTAGAGAGGAAGG + Intronic
1138542127 16:57694894-57694916 TGGCAGGGAAAGGGTGAGGCTGG + Intronic
1139427457 16:66891645-66891667 TGGCCTGGAATGAGTGGGGCTGG + Intronic
1141322431 16:83024409-83024431 TGGCAATGAAATTGTGAGTCTGG + Intronic
1141644737 16:85361449-85361471 TGGCCTGGAAAGAGGGAGACGGG - Intergenic
1203020614 16_KI270728v1_random:400455-400477 TGGCATAGAAATAGAGAAGTAGG + Intergenic
1203038949 16_KI270728v1_random:673613-673635 TGGCATAGAAATAGAGAAGTAGG + Intergenic
1203075779 16_KI270728v1_random:1121267-1121289 CGGCAGGGAAATAGTATGGCCGG - Intergenic
1144431610 17:15197604-15197626 TGGCTTGGTAATTGTGAGGACGG - Intergenic
1144679732 17:17185023-17185045 GGGCATGGAATGCGTGAGGCTGG + Exonic
1146540257 17:33687489-33687511 TGGCAGGGAAAGAGAGGGGCTGG - Intronic
1146768679 17:35548069-35548091 TGGCATTGAAATAGAGTGGAAGG + Intergenic
1146979602 17:37147646-37147668 TGACATGAAGATAGTGAAGCAGG + Intronic
1149167579 17:53771368-53771390 TGGCATGGGATTTTTGAGGCAGG - Intergenic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1152582742 17:81174330-81174352 TGGAAAGGAAAAAGTAAGGCTGG + Intergenic
1153247658 18:3088791-3088813 TGCCATGTAAATTGTGAGGCTGG - Intronic
1153713269 18:7820883-7820905 CGGCATGGAAATAGAGCAGCAGG + Intronic
1155525247 18:26709592-26709614 TGGGATGGAAAAAGTGAGGTAGG + Intergenic
1157331693 18:46708695-46708717 TGGAAAGGAACTGGTGAGGCAGG - Intronic
1158030261 18:52954985-52955007 TGGGATGGTCATAGTGAGGAAGG - Intronic
1159200200 18:65173877-65173899 TGGCATGGATACAGTGAGTGGGG + Intergenic
1160227460 18:77021982-77022004 TGGCATGGGAGGAGTGAGGTGGG + Intronic
1161074610 19:2279205-2279227 TAACATGGAAGTAATGAGGCTGG + Intronic
1161236746 19:3201998-3202020 TGGCATGGAGTGAGTGGGGCAGG - Intronic
1162474192 19:10889999-10890021 TGGGATGTAAATGTTGAGGCGGG + Intronic
1163610125 19:18296304-18296326 TGGCATGGAACAAGTGAGTGGGG - Intergenic
1163706329 19:18815856-18815878 GGGGATGGAGATAGTGAGTCTGG - Intergenic
1164167778 19:22697880-22697902 CGGCATTGAAATAGTGAGCGAGG + Intergenic
1164922891 19:32102914-32102936 TGGCAGGAAAATTGTGAGGGAGG - Intergenic
1166713200 19:44950300-44950322 AGGCAGGAAAATAGGGAGGCAGG - Intronic
1166969977 19:46559747-46559769 CGGCATGGAAACTGTGAGGAGGG - Intronic
1167732746 19:51270848-51270870 GGGAATGGGAATAGAGAGGCTGG + Intergenic
1167774750 19:51547454-51547476 TGCCAGGGAAATGGTCAGGCAGG + Intergenic
1168137800 19:54363165-54363187 TGGCATGGACAGGCTGAGGCCGG + Intronic
1168160221 19:54505468-54505490 TGGCATGGACAGGCTGAGGCCGG - Intronic
925651775 2:6098168-6098190 TGGCATGGAAGTAGTGAAAAGGG - Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
928696384 2:33853804-33853826 TGGCATAGAAAGAGTCAAGCAGG - Intergenic
930021042 2:47002491-47002513 TGGAAGGGAAAGAGTGTGGCTGG + Intronic
932281671 2:70498348-70498370 TGGCATGGGACTAGGGTGGCAGG + Intronic
933467811 2:82677631-82677653 TGGCATGAATAAAATGAGGCAGG - Intergenic
933608228 2:84406787-84406809 TGGCATGGACACAGGGAGGGAGG - Intergenic
933708497 2:85308550-85308572 AGGCAAGGAAATAGGGAGGGAGG - Intronic
933860181 2:86458743-86458765 AGGCATGGAAAAAGAGAAGCAGG + Intronic
933982220 2:87560122-87560144 AGGCATGGAAACAGTGAGTCTGG - Intergenic
934313240 2:91890109-91890131 TGGCATAGAAATAGAGAAGTAGG + Intergenic
936311618 2:111390688-111390710 AGGCATGGAAACAGTGAGTCTGG + Intergenic
937663475 2:124457921-124457943 TGGCATGGATATGGTGAGCAGGG + Intronic
937784786 2:125883788-125883810 TGGCATAGAAATTGTGTGGGAGG - Intergenic
937997983 2:127709489-127709511 TGGGATGGAAACAGAGAGCCTGG - Exonic
938664501 2:133520509-133520531 AGCCATTGAAATAGTTAGGCTGG + Intronic
940037691 2:149328583-149328605 TGGCAGTGAAATAGAGATGCTGG + Intergenic
940200662 2:151146575-151146597 TGTCTGTGAAATAGTGAGGCTGG - Intergenic
941589702 2:167404169-167404191 TGGCAAGGAAAAGGGGAGGCAGG + Intergenic
941710374 2:168705564-168705586 TGGCATGTAAATTGTCAGGAGGG - Intronic
942035797 2:172009555-172009577 GAGCATTGAAATTGTGAGGCAGG + Intronic
942734883 2:179097903-179097925 TGGCATTTAAAACGTGAGGCAGG - Intergenic
944600717 2:201300350-201300372 TGGCAAGGCAGCAGTGAGGCTGG + Intronic
945170952 2:206994392-206994414 TGGCAAATAAATAGTGAAGCTGG - Intergenic
945362984 2:208914174-208914196 TGGCATTCTAGTAGTGAGGCAGG - Intergenic
945809620 2:214532888-214532910 TGGCTTGGAAATACAGATGCTGG + Intronic
947316401 2:228863974-228863996 TGGCATGGAAATATTAATGCAGG - Intronic
1168907475 20:1417809-1417831 TGGGATGGGAAAACTGAGGCTGG - Intergenic
1168940161 20:1703495-1703517 TTGCATAGAATTAGTGAGACAGG - Intergenic
1169257460 20:4110116-4110138 TGGCAGGGAGATATTTAGGCTGG - Intergenic
1170594748 20:17796711-17796733 TGGGAGGGAAGAAGTGAGGCAGG - Intergenic
1172204102 20:33150058-33150080 TAGCCAGGAAATAGTGATGCTGG + Intergenic
1173140933 20:40482215-40482237 AGTCATGGAAATGGTGACGCTGG - Intergenic
1173231995 20:41205634-41205656 TGGCCTGGAATAAGTGCGGCAGG - Intronic
1174095988 20:48089829-48089851 TGTCATGGAAAGAATCAGGCGGG + Intergenic
1178096763 21:29223374-29223396 TGCCATGGAACCAGTGAGGCAGG - Intronic
1178407552 21:32336973-32336995 TCTCAGGGAAAGAGTGAGGCAGG - Intronic
1180539978 22:16435983-16436005 TGGCATAGAAATAGAGAAGTAGG + Intergenic
1181911673 22:26243316-26243338 TGCCATGGAGAAAGTGAAGCAGG + Intronic
1183167869 22:36161092-36161114 TGGCATGGAGGGAGTGAGGTGGG - Intronic
1183275264 22:36892480-36892502 TGGAGAGGAAATGGTGAGGCAGG + Intergenic
1183392104 22:37551557-37551579 TGGCTTGGAAATGGTCACGCTGG - Intergenic
1184059439 22:42073315-42073337 TGGCATGGAAAAACAGAGGAGGG - Intergenic
949309490 3:2680425-2680447 TGGCTCGGATACAGTGAGGCAGG + Intronic
950372443 3:12542561-12542583 TAGCCTGGATATGGTGAGGCAGG - Intronic
951723506 3:25727543-25727565 TGCTATGGAAACAGTGAGGTGGG - Intronic
951834178 3:26962983-26963005 AGGCAGTGAGATAGTGAGGCAGG + Intergenic
953626662 3:44577783-44577805 GGGCATGGAATGCGTGAGGCTGG - Intronic
954478698 3:50776221-50776243 TGGCATGGAAGTAGTGAAAAAGG - Intronic
955457191 3:59136352-59136374 TGGCTTGGGAAGAGTGAGGAAGG + Intergenic
956145592 3:66187991-66188013 AGACATGGTAATAGTGAGGAGGG - Intronic
958123478 3:89324846-89324868 TGGCAAGGAAAGAGGGAGGTGGG - Intronic
958814984 3:98904605-98904627 TGGCAGGGAAAAAGAGAGGGAGG + Intergenic
960167861 3:114424393-114424415 TGGCATGTAAATGGAGAGGTGGG - Intronic
961586210 3:127928061-127928083 TGGCATGGCTATACTGAGTCTGG + Intronic
962627441 3:137239876-137239898 TGGCATGGAGAAAGAGAGGAAGG + Intergenic
962828331 3:139119067-139119089 TGGAATGGAGGGAGTGAGGCTGG + Intronic
963023628 3:140897369-140897391 GGGCATGGCAAGAGTGAGACCGG - Intergenic
964845742 3:161042531-161042553 TGGCATGGAACTGGGGAGGGAGG - Intronic
964912886 3:161803344-161803366 TGGCTTTGGAATAGTGAGGAAGG + Intergenic
965228094 3:166017770-166017792 TGGCATGGATATAGTGAAAAGGG - Intergenic
966503057 3:180667913-180667935 TGAAATGGAAAAAGTGAGGTAGG + Intronic
966685957 3:182695833-182695855 TGGAATGGAAATAGTGAGAGTGG - Intergenic
966888385 3:184389101-184389123 TGGAATGGCACTTGTGAGGCAGG - Intronic
967341563 3:188404671-188404693 TGGCATAGTAATAGAGAGACAGG - Intronic
967397910 3:189027266-189027288 TGGCAGGGTCAGAGTGAGGCAGG - Intronic
967848265 3:194061826-194061848 TGGAATGTAAATACTGTGGCTGG - Intergenic
967958732 3:194901196-194901218 GGGCATGGCAGGAGTGAGGCTGG - Intergenic
970232337 4:13923541-13923563 TGACATAGAAAAAGTGAGCCTGG + Intergenic
970371064 4:15407146-15407168 GGGCATGGAAAAAGTGTGTCAGG + Intronic
970379460 4:15492595-15492617 CTGCATGGAAATTGTGAGGAGGG + Intronic
971589938 4:28454434-28454456 TGGCATGGATATAGTGAGCAGGG - Intergenic
972958998 4:44429034-44429056 TGGCATGGAGATGGTGAGAAGGG + Intronic
973233050 4:47864723-47864745 TGGCATGCAAATGGTGGGGCAGG + Intronic
973701171 4:53538773-53538795 TGGCTTGAAAATAATGAGACTGG - Intronic
974031953 4:56784278-56784300 AGGCAAGGAAACAGTGGGGCAGG - Intergenic
976501325 4:85793396-85793418 TGGTTTTGAAATAGTGGGGCTGG + Intronic
977180549 4:93868078-93868100 GGGCAAGGAATTAGTGTGGCAGG - Intergenic
977945443 4:102908162-102908184 TGGCATAGAAATAGAGAAGTAGG + Intronic
978411340 4:108429435-108429457 TAGCAAGGAAAAAGTGAGACTGG - Intergenic
980166507 4:129234407-129234429 TGTCATGAAAATAGAAAGGCAGG - Intergenic
980822187 4:138032443-138032465 TGGCATTGGAATAGTGGGGAAGG + Intergenic
980931824 4:139189350-139189372 AGGCTTGGATCTAGTGAGGCAGG + Intergenic
987440221 5:17946412-17946434 TGGCATGGATATAGTGAGAAGGG - Intergenic
988897788 5:35696908-35696930 GGCCATGAGAATAGTGAGGCAGG + Intronic
993516818 5:88846840-88846862 TGGAATGGATATAGTCTGGCAGG + Intronic
995773828 5:115702881-115702903 TGGCAGGTAAATGGCGAGGCTGG - Intergenic
996030249 5:118696845-118696867 TGGCATGGAAATGGGAAGGAGGG - Intergenic
997591997 5:135079806-135079828 TAGCCTGGACCTAGTGAGGCTGG - Intronic
997802798 5:136883640-136883662 GGGCATGGAAAGTGGGAGGCTGG + Intergenic
997965245 5:138351879-138351901 TACCATGGAATTAGTGGGGCTGG - Intergenic
999279599 5:150356612-150356634 TGGCAGGGAAAAGGTGAGGTAGG - Intergenic
1001354837 5:171009098-171009120 TGGCAGGGACAAAATGAGGCAGG - Intronic
1004065002 6:12235228-12235250 TTGTATGGAAAATGTGAGGCAGG + Intergenic
1004406589 6:15338755-15338777 TGGAAGGGAAAGAGTGAGACTGG - Intronic
1004629538 6:17408306-17408328 TGGCAAGGAAAAAATGAGCCTGG - Intronic
1004927257 6:20427737-20427759 TGGCATGGAAGGTGTGTGGCAGG - Intronic
1005196792 6:23296540-23296562 TTGCTGGGAAATAGTAAGGCTGG + Intergenic
1005861655 6:29907173-29907195 TGAAAAGGAAAAAGTGAGGCAGG - Intergenic
1006439291 6:34043211-34043233 TGGCCTGGAAAAAGTGTTGCTGG - Intronic
1007018576 6:38495681-38495703 TGTGATGGAACCAGTGAGGCTGG + Intronic
1008896966 6:56566986-56567008 TGGCTAGTAATTAGTGAGGCTGG - Intronic
1009298868 6:61989785-61989807 TTGCATGGAGATAGTAGGGCAGG - Intronic
1009891906 6:69695200-69695222 TGGGATGGAACTAGTGGAGCAGG - Intronic
1013280487 6:108631903-108631925 TGGCATGGAAAAAGGGGGGAGGG - Intronic
1014109814 6:117608030-117608052 TAACATGGAGATAGTGAGGCAGG + Intergenic
1014280080 6:119432531-119432553 TGTCATTGAAATAGTCTGGCAGG - Intergenic
1016072565 6:139757463-139757485 TTGCTTGGAAATAGTGAAGATGG + Intergenic
1020551833 7:9616093-9616115 CTGCATGGAAATTGTGAGGAAGG - Intergenic
1020957490 7:14759891-14759913 TGGCAAGGATATAGAGAGACTGG - Intronic
1021053057 7:16013020-16013042 TGGCATGGATGTGGTGAAGCAGG - Intergenic
1021226171 7:18029002-18029024 GGGGCTGGAAATAGTGAGGAAGG + Intergenic
1022480155 7:30738232-30738254 TGACATAGAAATTCTGAGGCAGG - Intronic
1023246588 7:38211408-38211430 GCGCATGGAAGTACTGAGGCAGG + Intronic
1026109972 7:67451269-67451291 GGGCAGGGAGATAGGGAGGCAGG - Intergenic
1028028363 7:85875676-85875698 TGGCATGGTGGGAGTGAGGCTGG + Intergenic
1028891037 7:95988855-95988877 TGTCATGGAAATAGTAAGGGTGG - Intronic
1033101332 7:138475170-138475192 TGGTATGGGAATGGTGAGGGGGG + Intronic
1033447064 7:141432454-141432476 TGGGATAAAAATAGTGATGCAGG - Intronic
1034434618 7:151057424-151057446 GGGTCTGGAAATAGTGAGGAGGG + Intronic
1036131771 8:6121476-6121498 TTCCAGGGAAAGAGTGAGGCTGG - Intergenic
1037163424 8:15798810-15798832 TAGCATGGAAATAGAGTTGCAGG - Intergenic
1037732903 8:21543453-21543475 TATCATGGAGAGAGTGAGGCTGG - Intergenic
1038199772 8:25401171-25401193 TGGCATGGAAATAGTGAGGCTGG + Intronic
1043182715 8:77105926-77105948 TTGCAAGGCAACAGTGAGGCTGG + Intergenic
1043539636 8:81245249-81245271 TTGAAAAGAAATAGTGAGGCTGG - Intergenic
1045382122 8:101637396-101637418 TGGCAGGCCAGTAGTGAGGCTGG + Intronic
1047165998 8:122439075-122439097 GGGAATGGAAGTGGTGAGGCAGG - Intergenic
1047937536 8:129797398-129797420 GGGCATGGTAAGAGTGAGACTGG - Intergenic
1049618714 8:143588297-143588319 GGGCATGGAAGTGGCGAGGCTGG - Intronic
1049753600 8:144297591-144297613 GGGCATGGAAGCAGTGAGGCAGG - Intronic
1050265449 9:3884760-3884782 TGGCAGGCAAATAGCGGGGCTGG + Intronic
1050649377 9:7758597-7758619 TGGAATGGAAAGAGTGAGGTAGG - Intergenic
1051482352 9:17574511-17574533 TGCAATGGAAATAGTGATGATGG + Intergenic
1051725528 9:20084696-20084718 TTGCATAGAAATAATGAGCCTGG - Intergenic
1052085533 9:24260935-24260957 TGGGATGGAAATAGGAAGGTTGG + Intergenic
1053321794 9:37105234-37105256 TGGCAGGCAAAAAGGGAGGCAGG - Intergenic
1055731395 9:79282488-79282510 TGGCATGGAAATGGCCAGGGGGG - Intergenic
1056383365 9:86075596-86075618 AGGCATGGAACTTGTGAGTCAGG - Intronic
1056692062 9:88816179-88816201 AGGCCTGGAGAGAGTGAGGCAGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1056772101 9:89485319-89485341 TGACAGTGAAATAGTTAGGCAGG - Intronic
1057517150 9:95731500-95731522 TGGAATGGAGATAATGAGGAGGG - Intergenic
1060993160 9:127860531-127860553 TGAGATGGAAAGACTGAGGCAGG - Intergenic
1061096394 9:128459367-128459389 TGGGATGGAAATAGGGTGACAGG - Intronic
1061397473 9:130351325-130351347 TGGCTTGTAAAAAGCGAGGCTGG - Intronic
1061809335 9:133153363-133153385 CGGCATGGGAACAGTGAGACAGG - Exonic
1062089445 9:134667456-134667478 TGGCTTGGAAGTGGTGTGGCCGG + Intronic
1203622023 Un_KI270749v1:135064-135086 GGGCAGGGAAATAGCGTGGCCGG - Intergenic
1189441887 X:41044469-41044491 TGGCAATGAAATAGTGAGAGTGG - Intergenic
1192230947 X:69264553-69264575 TGGCATGGGAATAGAAAGGACGG + Intergenic
1193405385 X:81094699-81094721 TGGCATGGATGTGGTGAGGAGGG + Intergenic
1194075173 X:89382144-89382166 TGGCAAGACAATGGTGAGGCCGG - Intergenic
1196763731 X:119224038-119224060 TGGCATTGAAGGAGTGATGCAGG + Intergenic
1198271131 X:135057024-135057046 TGCCATGGACATTATGAGGCAGG + Intergenic
1200829638 Y:7678388-7678410 TGGCTTGGAGAGAGTGGGGCAGG + Intergenic