ID: 1038200980

View in Genome Browser
Species Human (GRCh38)
Location 8:25412494-25412516
Sequence ATAACCCAGCTTGCTAAATT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038200980 Original CRISPR ATAACCCAGCTTGCTAAATT AGG Exonic
922033680 1:221827804-221827826 ATAAGTGAGCTTACTAAATTTGG + Intergenic
1065520140 10:26564340-26564362 AGAAACCAGCATGCCAAATTTGG - Intronic
1065557681 10:26932672-26932694 AGAAACCAGAATGCTAAATTTGG + Intergenic
1066109856 10:32186308-32186330 ATGACCCAGGTTGGTCAATTAGG - Intergenic
1066705603 10:38174687-38174709 ATAATCCTGCTTGAGAAATTGGG + Intergenic
1068501663 10:57846519-57846541 ATATCCCACGTTGCTATATTTGG - Intergenic
1074349493 10:112722139-112722161 GTAATCCAGGTTGATAAATTTGG - Intronic
1075778019 10:125000506-125000528 ATAAACCAGCTTGCTAGAGGCGG + Intronic
1076271889 10:129160767-129160789 ATAACCCAACTTGAAAAATAGGG + Intergenic
1086745111 11:90415798-90415820 ATAACCCTGTTTTCTCAATTAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092057259 12:5518291-5518313 ATAAACATGCTTCCTAAATTTGG - Intronic
1093748375 12:22769497-22769519 ATAACCAATCTTGATGAATTGGG + Intergenic
1095916542 12:47485832-47485854 ACAACTCAGATGGCTAAATTTGG - Intergenic
1097487529 12:60224441-60224463 ATAACCCTTCATGCTAATTTTGG + Intergenic
1098185588 12:67892854-67892876 AAACACCAGCTTGCTAAATTTGG - Intergenic
1098242937 12:68486877-68486899 ATAACCCAGTTTGTTAAAAATGG + Intergenic
1106276353 13:28211857-28211879 TTAACCCAGCTTACTACCTTGGG + Intronic
1109734517 13:66464735-66464757 TTAGCACAGCTTCCTAAATTTGG + Intronic
1111356384 13:87108981-87109003 ATAACTAATCTTGCTACATTTGG + Intergenic
1111661971 13:91222923-91222945 ATAACCCAGTTTGCAAAACTAGG + Intergenic
1111692516 13:91581980-91582002 GAAACCCAGGATGCTAAATTAGG + Intronic
1111833341 13:93357072-93357094 ATAACCCAGTTTCCTCCATTTGG + Intronic
1111871603 13:93839816-93839838 ATAACCCACCATGCTCAAGTGGG - Intronic
1112373629 13:98818169-98818191 ATAATATAGCTTACTAAATTAGG - Intronic
1113229579 13:108197322-108197344 ATATCCCAGCTATCTAAAATTGG + Intergenic
1119128683 14:72152154-72152176 ATCAGGCTGCTTGCTAAATTGGG + Intronic
1120587113 14:86326000-86326022 ATAATCCATCTTGTTAAATCAGG - Intergenic
1122198325 14:100106608-100106630 ATAACCTACCTACCTAAATTCGG - Intronic
1125968885 15:43896022-43896044 AGAATCCAGCTTGATAAAATGGG - Intronic
1127249538 15:57217429-57217451 ATAACCAAGGTTGCTTAGTTGGG + Intronic
1131686301 15:94771743-94771765 CTTACCCAGATTGCCAAATTGGG - Intergenic
1135201033 16:20437792-20437814 AAAGCCCAGCTTATTAAATTTGG - Intronic
1135218083 16:20590074-20590096 AAAGCCCAGCTTATTAAATTTGG + Intergenic
1144591703 17:16529745-16529767 ATAAGCCAGCCTGCTATTTTTGG + Intergenic
1149042497 17:52206599-52206621 AAAACCCAACTTTGTAAATTGGG + Intergenic
1150267448 17:63840745-63840767 AGAACCCAGCCAGCTAACTTTGG - Intronic
1153974756 18:10258839-10258861 TTAACACAGCTTGATAATTTGGG - Intergenic
1155930279 18:31699795-31699817 ATAACTCAGCTCACTAAAATAGG + Intergenic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1163950356 19:20578879-20578901 ATGACACAGGATGCTAAATTGGG - Intronic
1168368615 19:55812154-55812176 ATAACCCAGCTTTTGGAATTAGG + Intronic
925038080 2:707154-707176 AGAACCCAACTTTCTAAATGAGG - Intergenic
925167452 2:1726622-1726644 ACAAACAAGCTTGCTAAAATGGG - Intronic
937928227 2:127184007-127184029 ATAACCCAGCTTGCTGCAGGAGG - Intergenic
939362259 2:141187818-141187840 ATAAAGTAGCTTGCAAAATTGGG + Intronic
940071571 2:149694096-149694118 CTAACCCAGTTTGCAAAATCTGG + Intergenic
943199843 2:184807315-184807337 TTAACCCAGGTTGCTAAATTTGG - Intronic
944921256 2:204414989-204415011 ATATACCAGCATTCTAAATTAGG + Intergenic
945331307 2:208542187-208542209 ATAACACAACTAGCTAAAATTGG - Intronic
946221124 2:218227850-218227872 TTAACCCAGCCTGTTAACTTTGG - Intronic
946532431 2:220585945-220585967 GTAACCCAGCTAGCTGAATATGG + Intergenic
1169833879 20:9855872-9855894 ACAACCCATCCTGCTACATTTGG + Intergenic
1173154555 20:40596714-40596736 AAAACCCAGCTGGCTCAGTTGGG + Intergenic
1180914667 22:19477794-19477816 CTAATTCAGCTTGCTAATTTTGG - Intronic
1183452495 22:37904775-37904797 AGAACCCAGCTTGCCAATCTGGG - Intergenic
952045525 3:29314261-29314283 ATCAGCCAGCTAGCTAACTTTGG + Intronic
953187239 3:40649518-40649540 ATCATCCAGCTTGCTAAACTGGG - Intergenic
956691163 3:71878857-71878879 ATAAAGCAGCTTGCTGCATTGGG + Intergenic
962884899 3:139615298-139615320 ATAAACCAGCATCCTAATTTTGG - Intronic
963298548 3:143574167-143574189 CTCACACAGCTTGGTAAATTTGG + Exonic
967762156 3:193238436-193238458 ATGACTAAGCTTGGTAAATTAGG - Intergenic
970631075 4:17945635-17945657 ATAGCCCAACATACTAAATTAGG - Intronic
972112391 4:35580538-35580560 TTAACCCTTATTGCTAAATTAGG + Intergenic
972227729 4:37033265-37033287 AGAACCAAGACTGCTAAATTGGG - Intergenic
979091907 4:116493780-116493802 ATAACCAAGTTGGTTAAATTTGG + Intergenic
979361806 4:119774025-119774047 ATAACAAACCTTGCTAAAATTGG - Intergenic
979420932 4:120504149-120504171 ATAGCTCAGCTTACAAAATTGGG - Intergenic
979653171 4:123160217-123160239 ACAACACAGCATGCTAAATTAGG + Intronic
980870427 4:138605242-138605264 ACAAACAAGCTTGCTAAAATGGG - Intergenic
981236836 4:142426805-142426827 ATGACCTTGCTTTCTAAATTAGG - Intronic
984451215 4:179905431-179905453 ATTTCCCAGCTTTCTAAAGTTGG - Intergenic
986233785 5:5888966-5888988 AAAATACAGCTTTCTAAATTTGG - Intergenic
987383140 5:17304436-17304458 ATAACCGAGCTGGCTAAGTGAGG + Intergenic
988148827 5:27348683-27348705 ATAACCCAGCTGGAGAGATTAGG + Intergenic
997196402 5:131983141-131983163 ATAGCCCAGTTTGGGAAATTGGG - Intronic
997938582 5:138136074-138136096 ATAACCCAGGTTGGGAGATTGGG - Intronic
1000913375 5:167049700-167049722 ATAAGCAACCTTGCTAAATTAGG - Intergenic
1001682139 5:173566030-173566052 ATATCCCAACTACCTAAATTGGG - Intergenic
1003942362 6:11042819-11042841 ATAAAGCAGCTTGCTTTATTGGG + Intronic
1003945385 6:11070784-11070806 CTAACTTAGCTGGCTAAATTAGG - Intergenic
1004868396 6:19877135-19877157 ATAACACAGCTCCCTAAAATAGG + Intergenic
1008202988 6:48615389-48615411 AAATCTCAGCTTGCTAAAATTGG + Intergenic
1008934839 6:56979604-56979626 AAAAACCATCTTGCTTAATTGGG - Intronic
1009339094 6:62531509-62531531 ATGACCCAGTTTGGTAATTTTGG - Intergenic
1009535105 6:64872365-64872387 ATTAGGCAGCTTGCTAAATGTGG - Intronic
1010027554 6:71237467-71237489 ATATCCCAATTTACTAAATTTGG + Intergenic
1010585386 6:77652095-77652117 ATAACAAAGCTAGCTAAATTAGG + Intergenic
1011576818 6:88810351-88810373 ATTACTCAGTATGCTAAATTTGG - Intronic
1012811327 6:103962652-103962674 AAAACACAGCATGGTAAATTTGG - Intergenic
1013793922 6:113863468-113863490 ATAATCAAGCCTGCTAAAATAGG + Exonic
1016807765 6:148229585-148229607 ATAAAGCTGTTTGCTAAATTTGG - Intergenic
1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG + Intronic
1018097221 6:160399582-160399604 ATAACTCTGCTTCCTACATTTGG + Intronic
1019229006 6:170542011-170542033 AGCATCCAGCTTGCTAAGTTAGG + Intronic
1024946803 7:54816349-54816371 ATAACCCACCATGATCAATTGGG - Intergenic
1027765974 7:82342142-82342164 ATAACCTAGCTTTTTGAATTGGG + Intronic
1028971690 7:96866245-96866267 CTAACCCTCCTTGCTAAATAAGG + Intergenic
1032110550 7:129071795-129071817 AAAACACAGATTGCTAAACTGGG + Intergenic
1032756435 7:134895263-134895285 ATTATCCAGGATGCTAAATTTGG + Intronic
1036110590 8:5896604-5896626 ATAACCAAGAATGCAAAATTAGG + Intergenic
1038200980 8:25412494-25412516 ATAACCCAGCTTGCTAAATTAGG + Exonic
1039762917 8:40597395-40597417 ATAACTCAGATTGGAAAATTGGG + Intronic
1042267923 8:66927310-66927332 ACAGCCCAGGTTGCAAAATTAGG - Intergenic
1043035463 8:75192296-75192318 ATAAACCAGTTTTCAAAATTAGG + Intergenic
1045060914 8:98410129-98410151 AAAAACCAGCTGGCTAAAATCGG + Intronic
1048084659 8:131163635-131163657 ATAACCCATCTTCCTCAATCTGG - Intergenic
1051670637 9:19506241-19506263 ATAACCCAGTTTACTAAATTTGG + Intergenic
1051816497 9:21113158-21113180 TTCACCAAACTTGCTAAATTTGG - Intergenic
1057926553 9:99156684-99156706 ACAACCTTGCTTGCTGAATTAGG - Intergenic
1192958024 X:76094378-76094400 TTGACCTATCTTGCTAAATTGGG + Intergenic
1194480556 X:94416712-94416734 ATAACCTAGCAAGCTCAATTTGG + Intergenic
1196984969 X:121259144-121259166 GTTACCCAGTTTTCTAAATTGGG + Intergenic