ID: 1038208299

View in Genome Browser
Species Human (GRCh38)
Location 8:25490537-25490559
Sequence TGGGATTCCCATGAACAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038208299_1038208312 15 Left 1038208299 8:25490537-25490559 CCGGCCTGTTCATGGGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1038208312 8:25490575-25490597 GAATTGGCAGGTACGATGGATGG No data
1038208299_1038208305 -1 Left 1038208299 8:25490537-25490559 CCGGCCTGTTCATGGGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1038208305 8:25490559-25490581 AGGAGACCCTGGCCCAGAATTGG No data
1038208299_1038208306 3 Left 1038208299 8:25490537-25490559 CCGGCCTGTTCATGGGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1038208306 8:25490563-25490585 GACCCTGGCCCAGAATTGGCAGG No data
1038208299_1038208313 28 Left 1038208299 8:25490537-25490559 CCGGCCTGTTCATGGGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1038208313 8:25490588-25490610 CGATGGATGGTGAGAGTGAGAGG No data
1038208299_1038208310 11 Left 1038208299 8:25490537-25490559 CCGGCCTGTTCATGGGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1038208310 8:25490571-25490593 CCCAGAATTGGCAGGTACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038208299 Original CRISPR TGGGATTCCCATGAACAGGC CGG (reversed) Intronic
900316674 1:2060576-2060598 TGGGATTTCCATGATCTGCCCGG + Intronic
900626035 1:3609085-3609107 TGGGAATCTGATGAGCAGGCAGG - Intronic
901022871 1:6263893-6263915 TGGCTTTCCTATGAACAGGGTGG - Intergenic
903264720 1:22150902-22150924 TGGGATCCCCCTGCACAGCCTGG + Intergenic
907743584 1:57190537-57190559 TGATATTCACCTGAACAGGCTGG - Intronic
910689241 1:89948994-89949016 TGGGATACCCATGAAAAGAAAGG - Intergenic
911238605 1:95439640-95439662 TTGGATTTACATGAACATGCAGG + Intergenic
911344603 1:96681355-96681377 TGGTCTTGCCATGATCAGGCTGG - Intergenic
912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG + Exonic
918505465 1:185249324-185249346 TGGCATTCCTATCAACAGGCAGG - Intronic
919754695 1:201059374-201059396 GGGGCTTCCCAGGAAGAGGCAGG - Intronic
920651620 1:207841783-207841805 CGGGCTTCCCATGAGCAGACTGG + Intergenic
922724815 1:227917913-227917935 TGTGCTTCCCATGTCCAGGCTGG - Intergenic
1063715221 10:8520329-8520351 AGGGATTCCCATTCCCAGGCCGG + Intergenic
1063954620 10:11254939-11254961 TGGCATTCCCGTGAACGGGAAGG - Intronic
1066405990 10:35118962-35118984 TGGGGTCCCCAGGCACAGGCTGG + Intergenic
1070789988 10:79183201-79183223 GTGAATTCCCAAGAACAGGCAGG - Intronic
1072618241 10:97063664-97063686 TGGGGTTCCCACAATCAGGCTGG - Intronic
1074107399 10:110398767-110398789 TGTGATTCCCATGGAGACGCTGG - Intergenic
1074442979 10:113494954-113494976 TGGCATTCCAATGAGCAGGCTGG - Intergenic
1075467674 10:122663765-122663787 TGGTATTCCCATCCACAGGCAGG + Intergenic
1076542375 10:131222520-131222542 TGGGAGTCCCAGCACCAGGCTGG - Intronic
1077699982 11:4432218-4432240 TGGAATTCCCATGAGCAGAAAGG + Intergenic
1077758241 11:5059568-5059590 TGGGATCCCCAGCAACAGGAAGG + Exonic
1077760621 11:5092713-5092735 TGGGATCCCCAGCAACAGGAAGG - Intergenic
1089385036 11:118061843-118061865 TGGGAATCCCTTGAGCAGGGAGG - Intergenic
1093868912 12:24262866-24262888 TGGGATTACCATCAATAGACTGG + Intergenic
1097275131 12:57807914-57807936 TGGGATGCTCCTGAACAGGATGG - Intronic
1098059331 12:66543285-66543307 TGAGACTGCCATGAAAAGGCAGG - Intronic
1098603873 12:72366297-72366319 AGGGACTTCCAGGAACAGGCAGG - Intronic
1101193923 12:102363274-102363296 TGGGGTTGCCATGGTCAGGCTGG - Intergenic
1102620821 12:114193219-114193241 TGGGTTCCCCATGCACAGGGGGG + Intergenic
1102807716 12:115796500-115796522 TGGGAAACCCATTCACAGGCAGG - Intergenic
1102913207 12:116734571-116734593 TTGGATTCCCATGAAGTGGCTGG + Intronic
1107043276 13:35970939-35970961 TGGGCTACCTATGAACAGCCAGG + Intronic
1110683617 13:78346101-78346123 TGAGATTCCCATGAACATAATGG + Intergenic
1112566179 13:100552950-100552972 GGGGATACCCAGGAGCAGGCAGG + Intronic
1114134041 14:19826837-19826859 TGGGATTCTCGTGAACAGTCTGG + Intronic
1116601820 14:46935577-46935599 GGGGATTCCCAGAAAGAGGCAGG - Intronic
1117964087 14:61189199-61189221 TGGGATTCCCAAACACCGGCGGG - Intronic
1119210006 14:72824412-72824434 AAGGATTTCCATGAACAGGGAGG - Intronic
1122079768 14:99258431-99258453 TGGGATTCGCATGAATGGGGAGG - Intronic
1123019142 14:105389507-105389529 TGGGACTCCCAGGAAGAGCCTGG - Intronic
1123577112 15:21682427-21682449 TGGGATTCTCGTGAACAGTCTGG + Intergenic
1123613733 15:22124900-22124922 TGGGATTCTCGTGAACAGTCTGG + Intergenic
1126378994 15:48026805-48026827 TGAGCATCCCATGAACAGACGGG + Intergenic
1126414816 15:48406503-48406525 GGGCAGTCCCATGATCAGGCGGG - Intergenic
1130857684 15:87855554-87855576 TGGGATTCCCAGTACGAGGCAGG + Intergenic
1202985980 15_KI270727v1_random:416672-416694 TGGGATTCTCGTGAACAGTCTGG + Intergenic
1132646038 16:999762-999784 AGGGATTCCCAAGAGCAGGGAGG + Intergenic
1133497949 16:6337810-6337832 AGGGATTCTCAAGAAGAGGCAGG - Intronic
1134892184 16:17851073-17851095 TGGGGCTCGCATGCACAGGCCGG + Intergenic
1135241175 16:20807896-20807918 TGGGGACCCCATGGACAGGCAGG - Intronic
1135702320 16:24643145-24643167 TGGGGTTCCCATGAATGGGATGG - Intergenic
1135930373 16:26731168-26731190 GGGGATTCCAATGTGCAGGCAGG + Intergenic
1138222405 16:55264035-55264057 TGGCATCTCCAGGAACAGGCTGG - Intergenic
1139873270 16:70124707-70124729 TGGGAGTTCCATTAACTGGCTGG - Intronic
1140132490 16:72175859-72175881 TGTGAGCCCCATGAACAGACAGG + Intronic
1140362513 16:74356598-74356620 TGGGAGTTCCATTAACTGGCTGG + Intergenic
1141008372 16:80374236-80374258 TTGGATTCCCATGACCAGTTTGG - Intergenic
1141202029 16:81905490-81905512 TGGGATTCCATTGACCAGGTGGG + Exonic
1143204660 17:5133463-5133485 GGGAATTCCCATGAACATCCGGG + Exonic
1143314151 17:6018866-6018888 TGGAATGCCCATGTCCAGGCTGG - Intronic
1143951809 17:10638483-10638505 TCTGATTGCCAAGAACAGGCTGG + Intronic
1144024266 17:11263629-11263651 AGGGACTCTCATGGACAGGCAGG + Intronic
1144778991 17:17798546-17798568 TGGGGTTCCAAAGGACAGGCAGG + Intronic
1144875722 17:18396148-18396170 GGGCATTCCCATGAACATCCGGG + Intergenic
1145156504 17:20548273-20548295 GGGCATTCCCATGAACATCCGGG - Intergenic
1145760377 17:27422161-27422183 GGGCATTCCCATGAACATCCAGG + Intergenic
1145886147 17:28383893-28383915 GAGGATTCCCATGAGCAGACTGG + Intronic
1146883503 17:36456435-36456457 GGGCATTCCCATGAACATCCGGG - Intergenic
1148483089 17:47972986-47973008 TGGTATTCACATGTACAGGGTGG + Intronic
1148605920 17:48928694-48928716 TTGGATACCCTTGAAGAGGCTGG + Exonic
1149465155 17:56872635-56872657 TGGGCCTCCCATTATCAGGCTGG + Intergenic
1149465437 17:56875063-56875085 TGGGCCTCCCATTATCAGGCTGG + Intergenic
1149475686 17:56959312-56959334 TGGGTTTCCCATGCCCAGGCTGG - Intronic
1149847141 17:60014805-60014827 GGGAATTCCCATGAACATCCGGG - Intergenic
1150085500 17:62271422-62271444 GGGAATTCCCATGAACATCCGGG - Intergenic
1152178581 17:78803566-78803588 TGGGAGCCCCATGTACAGGAGGG - Exonic
1152434327 17:80265976-80265998 TGGGAAGCCCATGGCCAGGCTGG + Intronic
1152748003 17:82050055-82050077 GGGGAGTCCCATGAAGAGTCAGG - Intronic
1155184642 18:23376586-23376608 GGGGCTGCCCAGGAACAGGCAGG + Intronic
1161021908 19:2014826-2014848 TGGGATCCCGGGGAACAGGCTGG + Intronic
1161629271 19:5343991-5344013 TGGGTTTCCCAAGCACATGCTGG - Intergenic
1165164365 19:33841030-33841052 TGTCATTGCCATGAAAAGGCAGG - Intergenic
926197698 2:10773765-10773787 GGGGAGTCAGATGAACAGGCTGG - Intronic
927345692 2:22036276-22036298 TGGGATTCCCATGTATATGCAGG - Intergenic
931675987 2:64696729-64696751 TGAGATTCAGATAAACAGGCAGG - Intronic
931859163 2:66335536-66335558 TGGGCTTCCCATCAACTGGTAGG + Intergenic
932589337 2:73054612-73054634 CCAGATTACCATGAACAGGCAGG - Intronic
935198045 2:100832078-100832100 TGTGATTCTCATGACCAAGCTGG + Intronic
935783061 2:106524811-106524833 GGGGATTCCCATGTGCAGCCTGG - Intergenic
939549902 2:143602378-143602400 TTCGATTCCCAGGAACAAGCAGG - Intronic
940581485 2:155585201-155585223 TGGGTTTGCCATGCACAGCCTGG + Intergenic
942389689 2:175479143-175479165 GGGGATTCCAAAGAACAGCCAGG - Intergenic
944867632 2:203878121-203878143 TAGGATTGCTAAGAACAGGCTGG - Intergenic
947516295 2:230807783-230807805 TTGGATTCTTAGGAACAGGCAGG - Intronic
1170724010 20:18909722-18909744 TATGTTTCCCATGAATAGGCTGG - Intergenic
1171248228 20:23630210-23630232 TGGGATTGCCATGTGCAGCCAGG + Intronic
1173995030 20:47331450-47331472 TGAGACGCCCATGAACAGGCAGG + Intronic
1175191441 20:57214646-57214668 TGGGATGCTCAAGAACAGGCAGG - Intronic
1176018802 20:62952477-62952499 GGGGATTCCCAGCAGCAGGCCGG - Intergenic
1176058699 20:63162331-63162353 TGGGATTCCCCTTTTCAGGCCGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1177622248 21:23611412-23611434 GGGGAATCCCTTGAACAGGGAGG + Intergenic
1178582412 21:33847866-33847888 TGTGGTTCCCATGTACAGCCAGG - Intronic
1179424729 21:41266747-41266769 TGGGGTTCCCACGACCAGGAGGG - Intronic
1180024078 21:45148682-45148704 TGTGATGCCCATGAGCAGCCAGG - Intronic
1182093490 22:27611569-27611591 TGGGTTTCCCAGGGGCAGGCTGG + Intergenic
1184348312 22:43926266-43926288 TGGGATGCACAGGGACAGGCAGG - Intronic
952192906 3:31042807-31042829 TGGGATTCAAATGACCAGGCGGG + Intergenic
955548041 3:60052594-60052616 TCTGATTCCCAGGAAAAGGCAGG - Intronic
960053967 3:113263305-113263327 TGTGATCCCCAGGAACAGGCAGG + Intronic
960747178 3:120902994-120903016 TGGGTTTCAGATAAACAGGCAGG - Intergenic
961396962 3:126600391-126600413 AGGGATTCCCATGCATGGGCTGG + Intronic
963791456 3:149586966-149586988 AGGGATTCAGATGAACAGCCAGG - Intronic
963949807 3:151186607-151186629 TGGGAATGCCAGGAAGAGGCTGG - Intronic
969261916 4:6039009-6039031 CTGGATTCTCATGAACAGTCAGG - Intronic
970368892 4:15388533-15388555 TGGGATACACATGAACAGAAAGG + Intronic
970684742 4:18554113-18554135 TGGGATGCCCATCAACAAGTTGG + Intergenic
972597088 4:40539226-40539248 TGGGATTGCCTTGAGCAGCCTGG + Intronic
972602651 4:40586644-40586666 TGGGACTCCTGAGAACAGGCAGG + Intronic
972900785 4:43680575-43680597 TGGACTTCCCAATAACAGGCAGG + Intergenic
976341235 4:83947366-83947388 TGGAATACCAATGACCAGGCTGG - Intergenic
976826237 4:89263491-89263513 TGGGATTCAAATGGCCAGGCAGG + Intronic
979749388 4:124258701-124258723 TGGGATTCCCTTGTGCAGGCAGG + Intergenic
980910348 4:138988407-138988429 TGGGATTTCCATGCCCAGCCTGG + Intergenic
986409916 5:7467135-7467157 TGGATTTGCCATGAACTGGCTGG - Intronic
986676797 5:10192950-10192972 TGGGTTTCTCTTGAAAAGGCAGG + Intergenic
986874115 5:12085089-12085111 TGGGGCTCCCAGGAACTGGCAGG + Intergenic
988950853 5:36258830-36258852 AGTGATTCCAATGTACAGGCAGG - Intronic
992720550 5:79556976-79556998 GGGAATTCCCTTGAACAGGGAGG - Intergenic
1002324835 5:178397527-178397549 GCGGATGCCCGTGAACAGGCAGG - Intronic
1003079590 6:3010554-3010576 TGGGGTTCCCAGAAACAGGCAGG + Intronic
1003638939 6:7860384-7860406 TGGGATTCCCATGACAGGGAGGG - Intronic
1006831786 6:36972554-36972576 TGGGATTCTCAGCATCAGGCCGG - Intronic
1010471352 6:76231840-76231862 TGGGATTCCTTTGAAGAGACAGG + Intergenic
1013179814 6:107708279-107708301 GTGGATTCCCTTCAACAGGCTGG + Intronic
1014767353 6:125422095-125422117 TGGGAGTCGCCTGAGCAGGCGGG - Intergenic
1015554348 6:134445407-134445429 TGCTATTCCCATGCAGAGGCAGG - Intergenic
1018969755 6:168518091-168518113 TGGAATTCCGAGGAACGGGCAGG - Intronic
1019124120 6:169827897-169827919 GGGGATTCCAATGAGCAGCCAGG - Intergenic
1021667840 7:23004475-23004497 TATGATTTCCATGAAGAGGCTGG + Intronic
1023921293 7:44632190-44632212 TGGGATCCCCAAGAGCAGGAGGG + Intronic
1023967621 7:44971067-44971089 TGGGAAAACCATGAACAGTCCGG + Intronic
1024655469 7:51448048-51448070 TGGGATTCGAATGGCCAGGCGGG + Intergenic
1025263303 7:57437324-57437346 TATGATTCCCATGAGAAGGCTGG + Intergenic
1025635947 7:63318802-63318824 TATGATTCCCATGAGAAGGCTGG - Intergenic
1025646749 7:63429378-63429400 TATGATTCCCATGAGAAGGCTGG + Intergenic
1025740429 7:64191929-64191951 TATGATTCCCATGAGAAGGCTGG + Intronic
1028607752 7:92673648-92673670 GGGGATTTTGATGAACAGGCAGG - Intronic
1030550755 7:110956446-110956468 TGGAATTCTCCTGAACAGTCAGG + Intronic
1033012590 7:137638105-137638127 TGGGATTCCCTAGGGCAGGCAGG - Intronic
1033067405 7:138169181-138169203 TGTGATTCCCATGGGGAGGCTGG + Intergenic
1034396196 7:150826630-150826652 TGGCATTCCCATGATAAGGGAGG + Intronic
1035655411 8:1301579-1301601 AGGGACGCCCATGCACAGGCAGG - Intergenic
1036236757 8:7045551-7045573 GGTGATTCCCATGCACAGCCCGG + Intergenic
1036637831 8:10563992-10564014 TGGGATTGTCATCACCAGGCTGG - Intergenic
1038208299 8:25490537-25490559 TGGGATTCCCATGAACAGGCCGG - Intronic
1041363407 8:57075275-57075297 TGGGCTTCCCATGAACCAACAGG - Intergenic
1044388244 8:91616552-91616574 AGGGACTGCCATGAACAGGACGG + Intergenic
1050809515 9:9726364-9726386 TGGGATTCCCATTCAGAGGTAGG + Intronic
1051434530 9:17016876-17016898 TGTTCTTCCCATGCACAGGCCGG + Intergenic
1054928668 9:70614128-70614150 TAGCTTTGCCATGAACAGGCTGG + Intronic
1060523380 9:124307332-124307354 TGGCATTCTCAGGAAGAGGCAGG - Intronic
1185989655 X:4879016-4879038 AGGGATTCTTATGTACAGGCAGG + Intergenic
1198729068 X:139707805-139707827 TAGGATTCCCAAGTAAAGGCAGG - Intronic