ID: 1038218090

View in Genome Browser
Species Human (GRCh38)
Location 8:25581453-25581475
Sequence GTTGTATTTTCACCAAATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038218086_1038218090 7 Left 1038218086 8:25581423-25581445 CCTTGTTCTGGTCTCTGGGTGGA No data
Right 1038218090 8:25581453-25581475 GTTGTATTTTCACCAAATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038218090 Original CRISPR GTTGTATTTTCACCAAATAC GGG Intergenic
No off target data available for this crispr