ID: 1038220586

View in Genome Browser
Species Human (GRCh38)
Location 8:25603364-25603386
Sequence GAGCAGCTCATAGGCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038220583_1038220586 4 Left 1038220583 8:25603337-25603359 CCACTGAGCTATATTCTGAAGAA No data
Right 1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG No data
1038220581_1038220586 16 Left 1038220581 8:25603325-25603347 CCAGTGCCATTACCACTGAGCTA No data
Right 1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG No data
1038220582_1038220586 10 Left 1038220582 8:25603331-25603353 CCATTACCACTGAGCTATATTCT No data
Right 1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG No data
1038220580_1038220586 17 Left 1038220580 8:25603324-25603346 CCCAGTGCCATTACCACTGAGCT No data
Right 1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG No data
1038220579_1038220586 18 Left 1038220579 8:25603323-25603345 CCCCAGTGCCATTACCACTGAGC No data
Right 1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038220586 Original CRISPR GAGCAGCTCATAGGCCAAGG TGG Intergenic
No off target data available for this crispr